« April 2006 | Main | June 2006 »

May 31, 2006

The safety dance


- Derek Lowe's blog entries in the "Things I Won't Work With" category
- the explosion at the National Institution of Higher Learning in Chemistry at Mulhouse (which killed chemistry professor Dominique Burget)
- Karen Wetterhahn's tragic death in 1997

Chemistry just seems more dangerous than other scientific disciplines...

In the June 1st issue of Nature, Mark Peplow and Emma Marris investigated whether or not chemistry deserves its "reckless reputation." They talked with a number of safety officers from several universities, many of whom think that the dangers of chemistry are a bit exaggerated:

"A lot of it is reminiscence to 'the good old days' of chemistry," says Alan Kendall, safety officer at the University of Oxford, UK.
"There's a public perception that is years behind the reality," agrees Richard Firn, a biologist who chairs the laboratory safety committee at the University of York, UK. "Things have changed a lot in the past 10 to 15 years" ... "People's risk perception is skewed by the drama of an explosion" ...

But Mark and Emma acknowledged that it was "surprisingly difficult to get national statistics on scientific accidents ... [the UK Health and Safety Executive], for example, groups all its accident figures for schools, colleges and universities into a single number, making it difficult to discern safety trends or to tell if one type of lab is more risky than another."

Joshua


Joshua Finkelstein (Associate Editor, Nature)

The days of wine and cheeses


This month's issue of Wired magazine has two stories that have to do with chemistry - there's an article on the chemistry of cream cheese, which contains the following (choice) quote:

[John] Lucey is an associate professor of food science at the university and runs the cream cheese program. Born in Ireland, he came to Wisconsin for a professorship after making his name in yogurt research in Europe. [emphasis added]

For those of you who are interested in learning more about the field, you might want to check out a recent review article by Johnson & Lucey entitled "Major technological advances and trends in cheese."


There's also a story on the challenges of DIY chemistry in the post-9/11 world - it even has a few experiments to get you started (including how to make a stink bomb from wooden safety matches and household ammonia...) Though I'm not entirely sure the EPA would recommend this (after performing the "Lavalicious" experiment): "Transfer the chromium oxide to the widemouthed jar, seal, and discard."

This part of the article is a bit alarming/depressing:

More than half of the suggested experiments in a multimedia package for schools called “You Be the Chemist,” created in 2004 by the Chemical Educational Foundation, are to be performed by the teacher alone, leaving students to blow up balloons (with safety goggles in place) or answer questions like “How many pretzels can you eat in a minute?" ... “We want to give kids lessons that tie in to their real-world experiences without having them deal with a lot of strange chemicals in bottles that have big long names.”

This might explain why the number of B.Sc. chemists has been steadily decreasing since the mid-90s...

Joshua


Joshua Finkelstein (Associate Editor, Nature)

May 30, 2006

Everything bad is good again


One of my favorite scenes in Woody Allen's 1973 film Sleeper involves two doctors (for those of you who haven't seen this film, most of the movie takes place in the year 2173):

Dr. Melik: [puzzling over list of items sold at Miles' old health-food store] ... wheat germ, organic honey and ... tiger's milk.
Dr. Aragon: Oh, yes. Those are the charmed substances that some years ago were thought to contain life-preserving properties.
Dr. Melik: You mean there was no deep fat? No steak or cream pies or ... hot fudge?
Dr. Aragon: [chuckling] Those were thought to be unhealthy ... precisely the opposite of what we now know to be true.
Dr. Melik: Incredible!

I thought of this scene when I first heard about the possible beneficial properties of red wine (back in 1992, when Siemann & Creasy proposed that resveratrol might be responsible for the cardioprotective effects of red wine). Although I drink quite a bit of red wine, I hadn't really thought much about resveratrol until I read a new review article by Baur & Sinclair that's on the Nature Reviews Drug Discovery Advance Online Publication page.

Since that original report back in 1992, the number of papers exploring resveratrol's biological activity has skyrocketed: according to Baur & Sinclair resveratrol has been shown to "prevent or slow the progression of a wide variety of illnesses, including cancer, cardiovascular disease and ischaemic injuries, as well as enhance stress resistance and extend the lifespans of various organisms from yeast to vertebrates."

Not a big fan of red wine? No problem - there are many other natural sources of resveratrol, including grape juice, blueberries, and pistachios (although the concentration of resveratrol is much higher in red wine...)

We still need to learn more about the physiologically-relevant mechanism(s) of action, and the authors suggest that "blocking the metabolism of resveratrol, developing analogues with improved bioavailability, or finding new, more potent compounds that mimic its effects" will be important, as resveratrol is not cheap: "administering a daily dose to a human weighing 75 kg with 100 mg per kg (body weight) of resveratrol would require 2.7 kg of resveratrol a year, at a current cost of about US$6,800."

This blog entry has made me thirsty for some wine tonight - I think I'll stop off at the wine store on the way home and pick up a nice Syrah or maybe a bottle of French wine - anything red is fine, as long as it's not a Merlot...

Joshua


Joshua Finkelstein (Associate Editor, Nature)

Video killed the radio star

Perhaps I missed the memo? I am out of the office after all.

When did it become acceptable to take pictures during talks at a conference?

It’s day 2 at the European Materials Research Society Meeting in Nice, France and I’ve just left one session during which someone in the row in front of me took a picture of every single slide. At least they had the sense to turn off the flash on their camera – unlike the idiot standing at the back of the room. In a session yesterday, an announcement had to be made telling people to stop taking photographs. Ethical concerns notwithstanding (recording of unpublished results, preliminary data, etc...), it’s just downright rude and distracting, not only to the person presenting, but to the rest of the audience who are there to LISTEN to the talk.

To make matters worse, delegates at this conference have no idea how to turn off their mobile phones. In one talk, the speaker’s phone went off – at least it went unanswered. Every session, perhaps even every talk, has been punctuated with a series of ear-splitting beeps or some cute ring-tone or other – my personal favourite was a polyphonic rendition of the Macarena during a talk about organic field-effect transistors.

It’s quite ironic really – the devices responsible for my current torment are only possible because of advances in materials’ research. There’s no escaping the fact, it’s very much a material world.

Stuart


Stuart Cantrill (Associate Editor, Nature Nanotechnology)

May 26, 2006

Where's the magic gone?

Remember 'Magic Nano', the German cleaning product that has a lot of people worried about nanoparticles. Well, apparently it doesn't contain any.

Small Times reports that following an analysis of the product by the Verband der Chemischen Industrie (VCI) - the German chemical industry association - a recent meeting of the German Federal Institute for Risk Assessment (BfR) has concluded that there is no 'Nano' in 'Magic Nano'.

It turns out, that there's not all that much 'Magic' either - the analysis also revealed that the product did not contain the active ingredients that it was supposed to!!

Rene Zimmer of the BfR had this to say - ...at the meeting, the manufacturers said that had there not been a recall because of the breathing problems, there would have been complaints because "the stuff didn't do what it was supposed to do."

The many components of the product were manufactured by different companies and now the question of what happened to the active ingredients is being raised.

Nevertheless, Bernd Zimmermann, sales manager of Kleinmann, the company that distributed the product, does not seem to be all that concerned by the saga: "German consumers have a very short memory," he said. "Many haven't even heard about this."

Splendid. That makes it alright then.

Stuart


Stuart Cantrill (Associate Editor, Nature Nanotechnology)

May 24, 2006

Happy birthday, Nature Chemical Biology!


Nature Chemical Biology is now one year old, and the editors have put together a special anniversary issue to celebrate: in addition to the usual selection of exciting primary research, this issue has a meeting report by Jennifer Kohler on the recent American Society for Biochemistry and Molecular Biology meeting (which had a great series of talks in the "Chemical Genetics and Drug Discovery" section) and a review article by Jason Chin on synthetic biology. (If you're interested in synthetic biology, you might want to check out the Nature Newsblog for Oliver Morton's thoughts on the Second International Conference on Synthetic Biology.)

This special issue has a new section called "Elements," which "will feature interviews with key people in the chemical biology community and offer insights into places or events that are of general interest to chemists and biologists." In this issue, Joanne Kotz talks with Harvard Professor Jeremy Knowles.

Lastly, the editorial team at Nature Chemical Biology has put together a selection of papers from their first 12 issues, all of which are free for the month of June.

Joshua


Joshua Finkelstein (Associate Editor, Nature).

May 19, 2006

Hot stuff

Following hot on the heels of the h-index, we now have ‘m’, (I would have called it the ‘m-factor’), a measure of just how ‘hot’ a given research topic is. In this week’s issue of Nature, Jim Giles reports on how this analysis has been applied to selected scientific topics and compounds in order to determine what’s hot and what’s not. (The blog entry at Nature News can be found here)

Burning brightly at the top spot are carbon nanotubes, closely followed by nanowires, quantum dots, fullerenes and giant magnetoresistance. So, it’s official, nanotechnology is hot – perhaps Nature should launch a journal devoted to this exciting and vibrant topic..!

The h-index has received a lot of attention and there is no reason why ‘m’ won’t follow suit. If someone has a week or so to spare and applies this kind of analysis to get the top five in chemistry, let me know...

Stuart


Stuart Cantrill (Associate Editor, Nature Nanotechnology)

Ask an expert


If you're an organic chemist, you've probably already seen this blog entry, but for those of you who don't read Tenderbutton regularly, you should check it out. Dylan Stiles is a graduate student in the Trost group at Stanford, and a few weeks ago, 'Ask Tenderbutton' was conceived: you can send in your chemistry question/problem and Dylan will try to answer it/give you some advice. In addition, you'll also get plenty of suggestions from his regular readers - 'Debenzylating in Despair' has already received 20 comments from Dylan's readers. The best part: Dylan's asked people to write their questions in the cheesy 'Dear Ann Landers' style (hence the letter from 'Debenzylating in Despair'...)

I think this is a fantastic idea - there are lots of universities where you can't swing by another lab and talk with someone who developed the catalyst you're using or someone who might be able to give you some quick advice that can save you a few weeks of trial and error. This is especially true for chemists who are in laboratories at medical schools - the chemistry department might be across town... And since there are all sorts of little tricks that mean the difference between 20 and 90% yield, blogs might be the best way to quickly tap into a broad range of experts...

For some reason Dylan's entry reminded me of the InnoCentive project that was started a few years ago - I hadn't checked that site for a few years (and didn't know if the project was still running), but there are still a number of 'Challenges' in the chemistry and biology categories. With the long weekend coming up, maybe it's worth sitting down and taking a crack at some of those problems: for many of the challenges, the prize money is between 10,000 and 50,000 dollars (and I'd love a 61'' HDTV...)

Joshua


Joshua Finkelstein (Associate Editor, Nature)

May 12, 2006

I am the Lorax. I speak for the trees...


While flipping through yesterday's issue of Nature, I came across the special report on toxicology/toxicologists in the Naturejobs section... After struggling to get that infernal Britney Spears song out of my head, I read through the article, which really made toxicology sound like an interesting career...

Ricki Lewis wrote that a "career in toxicology might take a scientist to a contaminated well, a crime scene, a courtroom, an analytical chemistry lab or a political hearing" and "it isn't uncommon for a seasoned scientist to have spent time in academia, industry and government, and finish with private consulting." Considering how successful shows like CSI and Numb3rs are, I'm a bit surprised that no one's produced a prime-time TV drama starring toxicologists (I can see it now - EPA: Risk Assessment Unit...)


There's also a nice News & Views article by Robert Crabtree on a recent Science paper from the Goldman and Brookhart laboratories - in the presence of an iridium catalyst and a Schrock metathesis catalyst, the authors reported that a tandem alkane dehydrogenation/olefin metathesis reaction could be used to elongate inert hydrocarbon chains (technically, it's a tandem alkane dehydrogenation/olefin metathesis/alkane hydrogenation reaction, but that's a bit of a mouthful...)

The authors hope that this system could be used "turn coal, leftover oil refinery products or even plants into diesel fuel and other functional hydrocarbons." But Professor Brookhart acknowledged that "considerable improvements in the catalyst systems are required before they become practical."

Joshua


Joshua Finkelstein (Associate Editor, Nature)

May 11, 2006

Carry On Chemistry

There seems to be a little bit of silliness in the air... It started last week when Paul over at The Endless Frontier posted about a recent paper in Nano Letters with a slightly unusual title... It carried on this week when Dylan at Tenderbutton posted about a graphic graphical abstract from an Inorganic Chemistry paper (also noted by Paul a little while back). A handy resource for such silliness can be found here... which directed me to this humorously titled chem paper - can anybody out there beat that?!

Apparently physicists have a childish sense of humour too...

(For those of you curious about the title of this entry, ‘Carry On’ films are part of British film-making legend and have been described as, ‘an energetic mix of parody, farce and double entendres’ and, to be filed away in your 'interesting/unusual fact of the day folder', were produced by Peter Rogers, a namesake (if not exactly the same spelling) of the Chief Editor of Nature Nanotechnology – Peter Rodgers!)

Stuart


Stuart Cantrill (Associate Editor, Nature Nanotechnology)

May 08, 2006

Doing the worm...


Despite its small size (about one millimeter long), the nematode Caenorhabditis elegans has been used to study a wide range of "biological processes including apoptosis, cell signalling, cell cycle, cell polarity, gene regulation, metabolism, ageing and sex determination." Which is pretty amazing, as it truly is a simple organism: the adult hermaphrodite has 959 somatic cells!

In the May issue of Nature Reviews Drug Discovery, Kaletta & Hengartner wrote:

The cellular complexity and the conservation of disease pathways between C. elegans and higher organisms, together with the simplicity and cost-effectiveness of cultivation, make for an effective in vivo model that is amenable to whole-organism high-throughput compound screens and large-scale target validation.

I was surprised to learn that complex diseases can be investigated using this worm - scientists are even using it to "identify additional mode of actions of fluoxetine [an antidepressant] and to further elucidate the molecular mechanism of depression."

C. elegans is getting a lot of attention at NPG this week: in the May 4th issue of Nature, Kwok et al. screened 14,100 small-molecules in living worms and identified 308 compounds that induced a range of phenotypes, including slow growth, lethality, uncoordinated movement and morphological defects. One of these small-molecules (a 1,4-dihydropyridine that they named nemadipine-A) induced an Egl phenotype (egg-laying defects).

The authors then screened 180,000 "randomly mutated wild-type genomes" to look for dominant genetic suppressors of the nemadipine-A-induced phenotype, and they performed a number of follow-up experiments that indicated that the protein Egl-19 (the only L-type calcium channel alpha1-subunit in C. elegans) is a target of nemadipine-A.

This isn’t completely unsurprising, as other 1,4-dihydropyridines are known to "antagonize the alpha1-subunit of L-type calcium channels"), but it's an important demonstration that C. elegans can be used to quickly identify the targets of biologically active small-molecules - to quote Professor Randall Peterson, "[t]arget identification has been one of the thorniest problems in small-molecule screening, so this is a welcome and encouraging advance." And it's so simple, Professor Peter Roy (the lead author of the study) said "I could teach a first-year undergrad to do it"...

Joshua


Joshua Finkelstein (Associate Editor, Nature)

May 01, 2006

TCTTGTGAACCTACTATTTGTGCTCTTTGTCATTATATGATTTCTACT


It seems like every week there's some amazing new development involving 'lab on a chip' devices: in the May 9th issue of PNAS, Blazej et al. reported a nanoliter-scale microfabricated bioprocessor that was able to perform all three Sanger sequencing steps.

The device "incorporates a range of advanced lab-on-a-chip technologies, including miniaturized temperature sensing, nanoliter-scale Sanger extension reactions, microvalves/pumps, DNA affinity-capture, and high-performance CE." Like many other lab-on-a-chip devices, it's remarkably small (100 mm diameter) and the authors were able to sequence 556 continuous bases from 1 femtomole of a DNA template (with 99% accuracy).

Only 10e-15 moles of template? That's amazing! (And the raw sequencing data in Figure 4 looks fantastic...)

Since a "reaction containing 1 fmol of template generates [approximately] 26 times more product than is needed for detection,” the authors believe that they could run the reaction with only 100 attomoles of the DNA template. If this was done, “a sequencing reaction performed at standard concentrations in an easily fabricated 25-nl reactor [would represent] a 400-fold reduction in current sequencing reagent consumption.”

This is bound to make the NIH happy: "it still costs about $10 million to sequence 3 billion base pairs" and "NHGRI's near-term goal is to lower the cost of sequencing a mammalian-sized genome to $100,000, which would enable researchers to sequence the genomes of hundreds or even thousands of people as part of studies to identify genes that contribute to common, complex diseases." One of their long-term goals is to find a way to sequence a human-sized genome for $1,000 or less.

But the $1,000 genome would come with potential ethical concerns - I don't know about you, but I don't think I'd want my genome sequenced... I guess it would be good to know if I was genetically predisposed to get cancer or heart disease so I could take steps to prevent it, but part of me thinks that I'll enjoy life a bit more being blissfully ignorant... And what if the markers they discover are only right 90% of the time? Then I'd worry away my adulthood only to die of something else...

If you could get your genome sequenced during your next check-up, would you do it?

Joshua


Joshua Finkelstein (Associate Editor, Nature)

Subscribe

Subscribe to this blog's feeds:

[What is this?]

Recent Comments

Out of 754 total comments,
the most recent were:
Powered by
Movable Type 3.2