« Why did the chicken cross the road? | Main | Doing the worm... »

TCTTGTGAACCTACTATTTGTGCTCTTTGTCATTATATGATTTCTACT


It seems like every week there's some amazing new development involving 'lab on a chip' devices: in the May 9th issue of PNAS, Blazej et al. reported a nanoliter-scale microfabricated bioprocessor that was able to perform all three Sanger sequencing steps.

The device "incorporates a range of advanced lab-on-a-chip technologies, including miniaturized temperature sensing, nanoliter-scale Sanger extension reactions, microvalves/pumps, DNA affinity-capture, and high-performance CE." Like many other lab-on-a-chip devices, it's remarkably small (100 mm diameter) and the authors were able to sequence 556 continuous bases from 1 femtomole of a DNA template (with 99% accuracy).

Only 10e-15 moles of template? That's amazing! (And the raw sequencing data in Figure 4 looks fantastic...)

Since a "reaction containing 1 fmol of template generates [approximately] 26 times more product than is needed for detection,” the authors believe that they could run the reaction with only 100 attomoles of the DNA template. If this was done, “a sequencing reaction performed at standard concentrations in an easily fabricated 25-nl reactor [would represent] a 400-fold reduction in current sequencing reagent consumption.”

This is bound to make the NIH happy: "it still costs about $10 million to sequence 3 billion base pairs" and "NHGRI's near-term goal is to lower the cost of sequencing a mammalian-sized genome to $100,000, which would enable researchers to sequence the genomes of hundreds or even thousands of people as part of studies to identify genes that contribute to common, complex diseases." One of their long-term goals is to find a way to sequence a human-sized genome for $1,000 or less.

But the $1,000 genome would come with potential ethical concerns - I don't know about you, but I don't think I'd want my genome sequenced... I guess it would be good to know if I was genetically predisposed to get cancer or heart disease so I could take steps to prevent it, but part of me thinks that I'll enjoy life a bit more being blissfully ignorant... And what if the markers they discover are only right 90% of the time? Then I'd worry away my adulthood only to die of something else...

If you could get your genome sequenced during your next check-up, would you do it?

Joshua


Joshua Finkelstein (Associate Editor, Nature)

TrackBack

TrackBack URL for this entry:
http://blogs.nature.com/cgi-bin/mt/mt-tb.cgi/536

Comments

I'd totally pay $1,000 to see what diseases I stand a good chance of developing. At least, it seems better than increasing the frequency of colonoscopies and such. How about secretly sequencing your girlfriend's genome to see if she's mate-worthy? I guess it'd be over the line, but that probably wouldn't stop some people from doing it anyway.

Hmm... Good point - I guess if the choice was between getting my genome sequenced and having regular colonoscopies, I'd get my genome sequenced...

I presume you've both seen Gattaca...

Post a comment

Comments will be reviewed by the editors before being published. You can be as critical or controversial as you like, but please don't get personal or offensive. We strongly encourage you to use your real, full name. Email addresses are required: this is in case we need to discuss your comment with you privately, or notify you in case we decide not publish your comment. Email addresses will not be made public on the blog.


Please enter the numbers you see below - this helps us to cut down on spam. If you are having trouble with this system, you can instead e-mail a comment to 'thescepticalchymist at boston dot nature dot com '.

Subscribe

Subscribe to this blog's feeds:

[What is this?]

Powered by
Movable Type 3.2