Archive by date | May 2006

Doing the worm…

Despite its small size (about one millimeter long), the nematode Caenorhabditis elegans has been used to study a wide range of “”http://www.nature.com/nrd/journal/v5/n5/full/nrd2031.html”>biological processes including apoptosis, cell signalling, cell cycle, cell polarity, gene regulation, metabolism, ageing and sex determination.” Which is pretty amazing, as it truly is a simple organism: the adult hermaphrodite has 959 somatic cells!  Read more

TCTTGTGAACCTACTATTTGTGCTCTTTGTCATTATATGATTTCTACT

It seems like every week there’s some amazing new development involving ‘lab on a chip’ devices: in the May 9th issue of PNAS, Blazej et al. reported a nanoliter-scale microfabricated bioprocessor that was able to perform all three Sanger sequencing steps.  Read more