« TCTTGTGAACCTACTATTTGTGCTCTTTGTCATTATATGATTTCTACT | Main | Carry On Chemistry »

Doing the worm...


Despite its small size (about one millimeter long), the nematode Caenorhabditis elegans has been used to study a wide range of "biological processes including apoptosis, cell signalling, cell cycle, cell polarity, gene regulation, metabolism, ageing and sex determination." Which is pretty amazing, as it truly is a simple organism: the adult hermaphrodite has 959 somatic cells!

In the May issue of Nature Reviews Drug Discovery, Kaletta & Hengartner wrote:

The cellular complexity and the conservation of disease pathways between C. elegans and higher organisms, together with the simplicity and cost-effectiveness of cultivation, make for an effective in vivo model that is amenable to whole-organism high-throughput compound screens and large-scale target validation.

I was surprised to learn that complex diseases can be investigated using this worm - scientists are even using it to "identify additional mode of actions of fluoxetine [an antidepressant] and to further elucidate the molecular mechanism of depression."

C. elegans is getting a lot of attention at NPG this week: in the May 4th issue of Nature, Kwok et al. screened 14,100 small-molecules in living worms and identified 308 compounds that induced a range of phenotypes, including slow growth, lethality, uncoordinated movement and morphological defects. One of these small-molecules (a 1,4-dihydropyridine that they named nemadipine-A) induced an Egl phenotype (egg-laying defects).

The authors then screened 180,000 "randomly mutated wild-type genomes" to look for dominant genetic suppressors of the nemadipine-A-induced phenotype, and they performed a number of follow-up experiments that indicated that the protein Egl-19 (the only L-type calcium channel alpha1-subunit in C. elegans) is a target of nemadipine-A.

This isn’t completely unsurprising, as other 1,4-dihydropyridines are known to "antagonize the alpha1-subunit of L-type calcium channels"), but it's an important demonstration that C. elegans can be used to quickly identify the targets of biologically active small-molecules - to quote Professor Randall Peterson, "[t]arget identification has been one of the thorniest problems in small-molecule screening, so this is a welcome and encouraging advance." And it's so simple, Professor Peter Roy (the lead author of the study) said "I could teach a first-year undergrad to do it"...

Joshua


Joshua Finkelstein (Associate Editor, Nature)

TrackBack

TrackBack URL for this entry:
http://blogs.nature.com/cgi-bin/mt/mt-tb.cgi/537

Post a comment

Comments will be reviewed by the editors before being published. You can be as critical or controversial as you like, but please don't get personal or offensive. We strongly encourage you to use your real, full name. Email addresses are required: this is in case we need to discuss your comment with you privately, or notify you in case we decide not publish your comment. Email addresses will not be made public on the blog.


Please enter the numbers you see below - this helps us to cut down on spam. If you are having trouble with this system, you can instead e-mail a comment to 'thescepticalchymist at boston dot nature dot com '.

Subscribe

Subscribe to this blog's feeds:

[What is this?]

Recent Comments

Out of 1046 total comments,
the most recent were:
Powered by
Movable Type 3.2