- Reactions - Maitland Jones
- Tateshina 2009: Behind closed doors
- The role of referees
- Reactions - David Andrews
- How many elements have you used?
- Latest ChemPod online
- Nobel Laureate - Venki Ramakrishnan
- Materials Girl: Buried under a mountain of digital paperwork
- Reactions - Jonathan Sweedler
- And the winner is...
- Reactions - Jason Chin
- The shameless annual Nobel Prize speculation post
- Materials Girl: Upwards and onwards
- Reactions - Joost Reek
- Reactions - Laura Croft
- A reprieve for Cp?
- Podcast, videos and more!
- Reactions - Lisa McElwee-White
- Nobel reactions
- Reactions - Scott Mabury
- ACS: Organic highlights
- ACS: Afternoon with the chain gang
- ACS: Nanopower
- ACS: Beginning to see the light
- ACS: Open to ideas
- ACS: Pressurized preservation
- Reactions - George Stanley
- Reactions - Ann Valentine
- IUPAC '09: Magical molecular machines
- IUPAC '09: Thinking big to save the world
- IUPAC '09: Save the symbol!
- IUPAC '09: Chemistry in the main (group)
- IUPAC '09: posters and pink wine
- IUPAC '09: Carbon capture conundrums
- IUPAC '09: Tweet tweet!
- IUPAC '09: Livin' La Vida Loca
- IUPAC '09: Patenting bacteria
- IUPAC '09: Nanofun and marvellous MOFs
- IUPAC '09: Strontium sticks
- IUPAC '09: Mapping methanol in space
- IUPAC '09: saving the planet one atom at a time
- Reactions - Zachary Aron
- Putting the chemistry into sci-fi: Episode 3
- Putting the chemistry into sci-fi: Episode 2
- Materials Girl: Catching up
- Putting the chemistry into sci-fi: Episode 1
- Reactions - Kalai Saravanamuttu
- Reactions - Aaron Wheeler
- Educating Excimer: Room to fail
- Welcome to the periodic table Copernicium!
- Reactions - Nick Fisk
- Long time, no blog
- Reactions - Ian Fleming
- Lindau09: Twitter round-up #4
- Lindau09: Island hopping
- Lindau09: Twitter round-up #3
- Lindau09: And now for something completely different
- Lindau09: Reflections on day 2
- Lindau09: Twitter round-up #2
- Lindau09: Art meets science
- Lindau09: Twitter round-up #1
- Lindau09: Setting the scene
- Showing their metal
- Reactions - Lei Zhu
- Chemists take on immunology
- I love Paris
- On the road again
- Reactions - Richmond Sarpong
- Reactions - Aaron Wright
- Educating Excimer: The End of the 'Cookbook' Lab
- Reactions - Carolyn Bertozzi
- Editorial: Beyond the printed page
- Reactions - Erin Carlson
- Materials Girl: Expectations
- Reactions - Eugenio Coronado
- The RSC and ChemSpider
- Materials Girl: Readjusting
- Reactions - Ross Kelly
- Reactions - Kristopher McNeill
- Nature Chemistry issue 2 - live today
- Reactions - Alán Aspuru-Guzik
- Chempod: DNA litmus test and ACS round-up
- Reactions - Shana Kelley
- SciFinder and the small screen
- MRS: A good start
- Reactions - Ted Sargent
- Outsell and InChIs
- Materials Girl: Say, what?
- Where does lithium come from?
- Chemiotics: Chemists — masters of the Cartesian dualism
- Reactions - Jonathan Clayden
- Out and about in Japan
- Reactions - Andrew Dove
- ACS: Good to the last drop
- ACS: Press here
- ACS: How much do you want?
- ACS: Cells are weird
- JACS on your phone...
- ACS: How sweet it is...
- ACS: I went to SLC and all I got was...
- ACS: The mountains are to the east...
- Nature Chemistry, volume 1, issue 1
- Reactions - Stuart Cantrill
- Chemiotics: Binding physicality rather than chemicality
- Materials Girl: How time flies
- Reactions - Jacob Klein
- It's all going on...
- Reactions - Xueming Yang
- Chemist challenged
- Microtubes on YouTube
- Reactions - Andrew Weller
- ChemPod continues...
- Chemistry countdown complete
- NChem Research Highlights: Nanotube electrocatalysts, pentagonal prisms and corroding platinum
- Reactions - David Cahen
- A chemistry prescription
- Chemist's choice
- NChem Research Highlights: Total synthesis, boron boride and sensor arrays
- Reactions - Nicholas Long
- Spinning out
- Sugar Daddy: Not so boron after all
- NChem Research Highlights: Catalysis, catenanes and qubits
- Chemiotics: The further uses of redundancy
- Reactions - Lynn Loo
- NChem Research Highlights: Polymers, magnets and suprabowls
- Reactions - Rachel O'Reilly
- Science in trouble
- My little black book
- NChem Research Highlights: π interactions, field-effect transistors and ion recognition
- Reactions - Yun-Bao Jiang
- Learning to learn again
- Chemiotics: The death of the synonymous codon
- NChem Research Highlights: Straight iron, protein binding and H-graphene
- Reactions - Paul Plieger
- NChem Research Highlights: Cheap fuel cells, biopolymer threading and biosensors
- Reactions - Graeme George
- Reactions - Julie MacPherson
- Reactions - Luisa De Cola
- Materials Girl: The bell curve doth toll
- NChem Research Highlights: Biosensing dyes, strong biomimics and levitating beads
- Reactions - Ivan Dmochowski
- Top 10 Research Highlights of 2008
- All I want from Santa...
- They'd none of them be missed – why 20 amino acids and not 15?
- Crosspost: What element do you want for Christmas?
- NChem Research Highlights: Chiral alcohols, entrapment and nanotube motors
- Reactions - Hilary Crichton
- Free News & Views!
- The Sceptical Twitterer?
- NChem Research Highlights: Bryostatin, dendrimers and rowing microparticles
- Reactions - Cristina Lagunas
- Materials Girl: Old school, new school
- NChem Research Highlights: Twisting, diversity and order from disorder
- Reactions - Rory Waterman
- Sugar Daddy: Like sleeping with an elephant
- NChem Research Highlights: Metathesis, omniphobes and di-iron
- Reactions - Daniel Neumark
- Credit crunching
- Pimp my RSS
- NChem Research Highlights: graphene, the chemistrode and hypervalence
- Reactions - Paul Kruger
- Explain it to me
- Journal journeys: Day 285, Relocation, relocation
- NChem Research Highlights: BO, drag and knotty molecules
- Reactions - Andrew Wilson
- Oooh! Aaaah!
- NChem Research Highlights: layering liquids, double metallocenes and fixing fingerprints
- Reactions - Dongyuan Zhao
- Chemiotics: Sherlock Holmes and the Green Fluorescent Protein
- Hic!
- Materials Girl: Scientific debate
- NChem Research Highlights: Bimetallic nanoparticles, oxo complexes and those blue bananas
- Bumper ChemPod edition
- Reactions - Daniel O'Leary
- Journal journeys: Day 266, We're hiring!
- System requirements
- NChem Research Highlights: Bidentate ligands, squares and chirality
- Reactions - Jean-Claude Bradley
- NChem Research Highlights: Strain, MOF tags and a certain prize
- Reactions - Cameron Neylon
- Nobel Prize 2008
- The science scoop
- NChem Research Highlights: Oxonium, feedstocks and enzymes
- Reactions - Anne Pichon
- Look my way
- Where's my Nobel fix?
- Chemiotics: Auditing P-Chem
- NChem Research Highlights: Ultracapacitors, nitrogen cleavage and applied asymmetric catalysis
- Reactions: Saiful Islam
- Materials Girl: Living with chemists
- Ernest Eliel
- RSC Roadmap
- NChem Research Highlights: Organo-photo-catalysis, funny fullerenes and anti-freeze proteins
- Taking solace in synthesis?
- Reactions - Michaele Hardie
- Double the fun??
- NChem Research Highlights: Ion transport, f-block ionic liquids and gold catalysis
- Reactions - Jun Okuda
- Alphabet of elements
- NChem Research Highlights: Paper devices, T-jumps and defluorination
- Chempod: Going green
- Reactions - David Milstein
- Materials Girl: Flights of fancy
- Chemiotics: Apologies to Borodin
- NChem Research Highlights: Patterning, MOFs and ligands
- Reactions - Anna Balazs
- NChem Research Highlights: Mars, mass spec and metals
- Reactions - Judy Kim
- ACS: Philadelphia 2008 - Love Train
- ACS Philadelphia 2008: Something to "Chu" on
- ACS Philadelphia 2008: Escaping the conference
- ACS Philadelphia 2008: When will cheap solar power become reality?
- ACS - Picture this
- ACS Philadelphia 2008: On the presidential campaign trail
- ACS Philadelphia 2008: The Boss
- ACS Philadelphia 2008: Phys Chem heavyweights
- ACS - Neuro-logical
- ACS Philadelphia 2008: Viruses make batteries
- ACS - Thanks for the memories
- ACS Philadelphia 2008: Posters...
- ACS Philadelphia 2008: Bad luck strikes - twice
- ACS Philadelphia 2008: Big talk
- ACS Philadelphia 2008: Trees eat pollution
- NChem Research Highlights: Fullerenes, opalescent arrays and hydrogels
- ACS - Movie stars
- Angstrom olympics!
- ACS Philadelphia 2008: Board
- ACS - Chemistry issues
- Reactions - Catherine Murphy
- You put your left hand in...
- NChem Research Highlights: Natural products, light-harvesting and water-splitting
- Reactions - Neil Withers
- Journal journeys: Day 189, Paper trail
- Materials Girl: Delays
- NChem Research Highlights: Arenes, rotaxanes and rotors
- Reactions - Omar Yaghi
- Factoring in a sweet tooth
- Journal journeys: Day 179, Picture this...
- NChem Research Highlights: carborane MOFs, metal-ion sensing, and coordination polymers
- Reactions - Ronald Breslow
- ICCC38: Coordination chemistry
- NChem Research Highlights: Isotopes, proteins and reactive intermediates
- Flown the coop
- Reactions - Gavin Armstrong
- Who’s the greatest Russian (scientist)?
- Seeing single atoms in a TEM
- Belgian BOSS
- Chemiotics: Unrequired reading
- Periodic Table of Videos
- Materials Girl: Comparisons
- NChem Research Highlights: Ionic liquids, electronic noses and tuning tubes
- Reactions - Heather Maynard
- Materials Girl: Silence speaks for itself
- NChem Research Highlights: Self-healing coatings, bacterial inhibitors and single-molecule magnets
- Reactions - Stephen Davey
- DD11: Stanford and Scripps
- NChem Research Highlights: total synthesis, multimetallic complexes, and photoresponsive elastomers
- Reactions - Aline Miller
- Amazing green moving light thingy. It's chemistry!
- ChemPod 6
- DD11: Main group rennaisance
- Take me to your... workplace
- NChem Research Highlights: cell metabolites, chocolate, and hydrogenation catalysis
- Reactions - Harry Kroto
- Non-deep thoughts by Catherine Goodman
- Chemiotics: A chemical double entendre
- Reactions - Cameron Alexander
- NChem Research Highlights: stereochemistry, switches and molecular electronics
- Name that tune in three elements
- Sugar Daddy: The importance of being... there
- Journal journeys: Day 132, Out and about
- ¡Gol!
- NChem Research Highlights: superconductivity, protein folding and cross-coupling
- Reactions - Polly Arnold
- Chemiotics: A chemical gedanken experiment
- Reactions - Francesco Stellacci
- NChem Research Highlights: capsules, spectroscopy and nanomachines
- Dodge this.
- Reactions - Marty Burke
- NChem Research Highlights: silenes, cortistatin and magnetic beads
- JACS 2.0
- The platypus as inspiration
- Reactions - Penny Brothers
- NChem Research Highlights: viscosity, nanotrees and solid-state synthesis
- Chemiotics: Do you know where your drug is (and what it is doing)?
- Materials Girl: A watched TLC plate never rises
- Prospective Professor: The Beginning After the End
- Reactions - Arata Yajima
- NChem Research Highlights: Hydrogels, viral mimics and helical foldamers
- JJ: Day 98, Service with a 'Simplified Molecular Input Line Entry Specification'
- Chemiotics: Why should a (biological) protein have one shape?
- NChem research highlights: Buckyballs, self-assembly and antitumour agents
- Reactions - Molly Shoichet
- Diamond studies...on diamond
- First impressions
- Birth of a legend?
- Death of a legend
- Sex and the chemist
- Reactions - Donald Tomalia
- Nature Chemistry research highlights
- Journal journeys: Day 84, Team Chemistry
- I'd like to teach the world to do a perfect TLC...
- Chemiotics: Why should a protein have one shape?
- ChemPod 5
- Here comes the judge
- Reactions - Martin Schröder
- Rookie Rocky: Establish your own brand
- Journal club - Marty Burke
- Materials Girl: The science of appliance
- Chemiotics: How many proteins can we make?
- Reactions - Toshimi Shimizu
- ACS: Flight of fancy
- ACS: While stocks last...
- ACS: Picture this
- ACS: Big, but certainly not easy...
- Reactions - Barney Grubbs
- Materials Girl: Questions...
- Chemiotics: Causality in the cell and how puppies give us hope
- Communication let me down
- A burner by any other name...
- Reactions - Phil Gale
- Beating nature to save the planet
- Journal journeys: Day 54, Housekeeping
- Reactions - Gary Siuzdak
- Chemiotics: The vanishing simplicity of chemical pathways in the cell
- I've got the whole issue in my hands...
- Reactions - Tom Welton
- Materials Girl: Then and now
- Chemiotics: The decline of the master gland and the rise of feedback
- I (don't) believe in miracles
- Sugar Daddy: This chemical reaction was brought to you by...
- The more things change, the more they stay the same...
- Reactions - Maurizio Prato
- How to disappear completely
- Chemiotics: Is math harder than organic chemistry?
- Holy science, Batman!
- CFCs: What is right?
- In a spin
- Nice work if you can get it?
- Reactions - Ben List
- Prospective Professor: Decisions, Decisions, Decisions
- Chemiotics: The unbearable weirdness of quantum mechanics (with apologies to Kundera)
- Journal journeys: Day 25, First contact
- Rookie Rocky: Show me the money!
- Open chemistry
- Reactions - One year old today!
- Journal journeys: Day 21, Cover story
- Chemiotics: We had to destroy the village to save it
- Materials Girl: To sheet or not to sheet
- Charge complete
- Journal journeys: Day 18, Objecting to objectives
- President of What?
- ChemPod 4
- Reactions - Stuart James
- Chemiotics: Introduction and allegro
- Journal journeys: Day 14, Driven to distraction
- Chemistry in fantaseo
- (You make me feel like) a chemistry professor
- Hard times for rubber farmers
- Reactions - Carsten Schmuck
- Journal journeys: Day 1, Swamped!
- Reactions - Tony James
- Bringing something new to the table
- Journal journeys: Day -2, The long and short of it
- Flat-out carbon
- Where the chemistry has no name
- Reactions - Angel Kaifer
- Journal journeys: Day -8, The colour of chemistry
- Materials Girl: Aftermaths
- Journal journeys: Day -11, Deadline day
- Reactions - Eric Scerri
- Game on!
- Prospective Professor: On the road again
- I've got you under my skin
- Reactions - Harry Gibson
- Mercury rising (from the dead)
- The world of nano at your fingertips...
- Takin' care of business
- Reactions - Howard Colquhoun
- Reactions - Younan Xia
- Reactions - Steve Nolan
- Materials Girl: The end product
- The (not so) secret lives of chemists
- Here fishie, fishie, fishie...
- Reactions - Taeghwan Hyeon
- Now I’m cookin’
- Materials Girl: Procrastination...
- Sugar Daddy: HPLC, I'm stuck on you
- Reactions - David K Smith
- Ion awe
- Degraded by the light
- War... what is it good for?
- The old ones are always the best
- Reactions - Klaus Theopold
- Prospective Professor: The Employment Pages
- Rookie Rocky: About teaching
- Reactions - Paul Low
- Materials Girl: Why not?
- Nature Chemical Biology is coming to town
- Reactions - Frank van Veggel
- ChemPod the third
- Reactions - Neil Champness
- Interview with a chemist
- I'll be the judge of that...
- Reactions - Ben Davis
- Sugar Daddy: Do not pass ‘Go’, do not collect $200
- Chemical showers
- Chemical communications
- Materials Girl: Synthetic limericks
- Reactions – Simon Webb
- Chemistry for chemistry's sake
- Art for chemistry's sake
- I believe that children are our future
- Reactions – Mark Green
- Rookie Rocky: A Tale of Two Sciences
- Prospective Professor: Against All Odds
- Nano prizes
- Reactions - Jeroen Cornelissen
- Did you hear the one about nanotechnology and football...
- Eyes on the prize
- Materials Girl: Moving up
- Reactions – Steve Marsden
- Materials Girl: Moving around
- Materials Girl: Moving in
- Under the gun
- Reactions - Duncan Bruce
- Focusing in on mass spectrometry
- Sugar Daddy: Looking both ways
- Imaging is dino-mite!
- Someday we'll all be free
- Reactions - Milo Shaffer
- Six degrees of Stuart Schreiber
- Time, time, time
- Structurally unsound
- Reactions - Marcus Weck
- 10 Miles from Academia: The Cost of Independence
- No prizes for guessing...
- Fear and loathing
- Rookie Rocky: A rookie “business-class” passenger in a seminar room
- Materials Girl: Whatever can go wrong, will...
- CFCs: So do I miss being a chemist?
- Reactions - Rein Ulijn
- A little quiz
- ChemPod 2
- News from Nature Protocols
- Reactions - Peter Cragg
- I've got my spine...
- Materials Girl: Physics, summer school, and math – oh my!
- Reactions - Mary Cloninger
- ACS: The party's over
- ACS: Homecoming
- ACS: Friends reunited
- ACS: Worms
- ACS: Hot secrets
- ACS: Marbles, I've lost mine
- ACS: Factoids
- ACS: Time's (nearly) up
- ACS: Strictly ballroom
- ACS: In my opinion, the drug is ready
- ACS: Avogadro's out
- ACS: In the best possible taste
- ACS: So long, and thanks for all the fish
- ACS: Katharine the gourmand
- ACS: Hello... Are there any bloggers out there?
- ACS: When will I learn
- ACS: Analyse this
- ACS: Hydrogen hiccups
- ACS: Poets corner
- ACS: Going the distance
- ACS: News hound arrives at last
- ACS: It's better to travel...
- ACS: Here I go again
- Reactions – S. Thayumanavan
- North by Northwestern
- Nobelium - No!
- Nature Chemistry
- Materials Girl: A quick thought
- Totally natural
- CFCs: What makes a good presentation?
- Hail to the Chief
- Materials Girl: An introduction
- Reactions - Len MacGillivray
- Doctor who?
- You say tomato...
- Reactions - Darren Hamilton
- My dry box is still better than your dry box
- Enzymes, macrocycles, and fluorescent dyes, oh my!
- For screening purposes only
- Reactions - Pavel Anzenbacher
- I heart chemistry
- My dry box is better than your dry box
- Doin' what comes naturally
- Reactions - Lee Cronin
- Talk talk
- Glasses, glasses everywhere, but not a drop to drink
- No room at the inn
- Reactions - Heather Carlson
- CFCs: Bingo!
- Now you see 'em...
- Badly drawn bonds
- Reactions - Stuart Rowan
- Fireworks come alive! ALIVE!!!
- Podcast killed the radio star
- I can't live without my radio...frequency pulse
- Reactions - Glen Miller
- I'm into something good
- Fashion
- Whiskey in the jar
- The NIHghts who say 'no'
- Reactions - Catherine Goodman
- In the Summertime
- CFCs: Confessions of a former chemist
- Man in the mirror (on the moon)
- Outnumbered
- Chemical biology, au naturale?
- Respect
- Reactions - Joshua Finkelstein
- A knight's tale
- Oh happy day
- Reactions - Miguel Garcia-Garibay
- Light up my life
- Reactions - Andy Mitchinson
- The weight
- Reactions - Joe Sweeney
- Singin' in the ... lab
- They might be giants
- Anarchy in the UK
- It's economics, stupid
- Living in a material world...
- Reactions - Derek Lowe
- Insane in the brain!
- London calling
- Gene genie
- Crazy frogs
- Nanotubes - Pasteurized!
- I'd like to buy the world a Coke
- Reactions – Nadrian Seeman
- Ich muss einen Blog schreiben...
- Reactions - John Anthony
- The yellow (and red, blue and green) brick road
- A nanotube fix
- Endangered elements
- Add it up
- Reactions - Jonathan Steed
- Pour some sugar on me
- Who's the hardest of them all?
- Reactions - Tom Muir
- On the streets of Philadelphia
- May Day comes early
- 50 ways to write a (cover) letter
- Reactions - Shuguang Zhang
- Pure and simple
- Learning Japanese, I think I'm learning Japanese...
- Very superstitious...
- Reactions - Vince Rotello
- Going postal
- ACS: Slow writer (part 3), or, Go Phoenixes!
- Roll with it
- ACS: Slow writer (part 2), or, Nature will find a way...
- Reactions - Mike Zaworotko
- ACS: Slow writer (part 1)
- ACS: It's over
- ACS: Cold fusion anyone?
- ACS: What happened today?
- ACS: Crowded house
- ACS: Caught in a trap
- ACS: Hero worship
- ACS: Take a walk on the wild side
- ACS: Chemists, chemists everywhere and not a drop to drink
- ACS: The wheels on the bus (don't move at all...)
- ACS: milk is dairy, right?
- ACS: Dean Martin tribute
- ACS: Listen up kids, it could happen to you
- ACS: Rage for the machine
- ACS: Lost in space
- ACS: I fought the law...
- ACS: Like a virgin
- ACS: My kind of town
- ACS 2007 - Nature newsblog
- NPG at the 2007 Spring ACS meeting
- Reactions - Fraser Stoddart
- Mechanical chemistry
- Comin' atcha, NChB style
- Making a list...
- Reactions - AP de Silva
- In the bag?
- Reactions - James Tour
- Don't know much about chemistry...
- Back from hiatus...
- The edges of our material world
- Reactions - Bruce Gibb
- Making sense of science
- Porphyrin power
- A bygone age
- Reactions - David Leigh
- Sparkly science
- Go nuclear?
- What's black and white and read all over?
- People are people, so why should it be...
- Anything you'd like to share?
- Time is on my side
- I've got the power
- A cluster of chemists(?)
- Labspeak, STAT
- Soft science
- Day TRP-per
- The devil is in the details...
- Demons lurking
- (Your love is like) bad medicine
- DIY Drug Discovery
- Tubulin is red, violets are blue, isofagamine is sweet, and so are you!
- Heard that talk about short'nin' bread?
- Nano pants!
- Feeling hot, hot, hot!
- New nano knight
- And the award goes to...
- The J-factor
- Click click bang bang
- My own, personal, Mr. Roboto
- Next week's Novartis symposium...
- Feedback loop
- It’s Greek to me!
- Giving the gift of drugs
- If you don't eat yer meat, you can't have any pudding...
- Say it with flours
- Insane in the membrane!
- Talk talk
- A false economy
- All the small things
- Nobel update
- The Hunt for Read October
- Better late than never...
- I left my phone in San Francisco
- Grand theft auto: Levinthal paradox city
- The Stockholm syndrome
- ACS: The Rainbow Connection
- ACS: Poly want an enzyme?
- ACS: Sittin' on the dock of the bay
- ACS: butternut squash soup
- ACS: Conference bon bons
- ACS: Clicking and beeping
- ACS: Sweet surrender
- ACS: All that glitters is gold
- ACS: I love technology
- ACS: Mongolian Licorice
- ACS: Nobel laureate book club
- ACS: Against "molecular gastronomy"
- ACS: Ah, high culture
- ACS: Fuelmen
- ACS: Big in America
- Goin' back to Cali
- It's not easy being green
- NPG at the 2006 Fall ACS meeting
- Sympathy for the chemist
- I still haven't found what I'm looking for
- European Chemistry Congress: Viszontlátásra
- European Chemistry Congress: Gold medal
- European Chemistry Congress: Quite a jar
- 2 + 2 = 5
- European Chemistry Congress: Bon bons of interesting chemistry
- Turn on, tune in, kill cells
- Su Doku goes periodic
- European Chemistry Congress: Chemical Darwinism
- European Chemistry Congress: I heart food chemistry
- A bottle of red, a bottle of white
- European Chemistry Congress: Panacea in the water?
- European Chemistry Congress: more blogging from Budapest.
- European Chemistry Congress: the reception
- European Chemistry Congress: Jó napot kívánok
- Come together
- The right chemistry
- Endosymbiotic by nature
- Snakes on a Protein
- Almost Famous
- Fame (I'm gonna live forever...)
- The big picture
- The best of what’s around
- A chilling end
- The incredible shrinking lab
- GRC: Ice ice baby
- A penny for your thoughts
- Toxins are busting out all over
- Don't sweat the small stuff
- Growing pains in chemical biology
- Bring on the beer
- Nature Protocols
- Save the date
- Don't call it a comeback...
- We gotta get out of this place
- On the ball
- Bruce Merrifield
- Twisting the night away
- You down with NNB? (Yeah you know me...)
- OK Computer
- It's all about the Benjamins
- Summertime
- The safety dance
- The days of wine and cheeses
- Everything bad is good again
- Video killed the radio star
- Where's the magic gone?
- Happy birthday, Nature Chemical Biology!
- Hot stuff
- Ask an expert
- I am the Lorax. I speak for the trees...
- Carry On Chemistry
- Doing the worm...
- TCTTGTGAACCTACTATTTGTGCTCTTTGTCATTATATGATTTCTACT
- Why did the chicken cross the road?
- Bucking bucky beliefs
- And the Oscar goes to...
- Of global warming and hurricanes
- Pimp my nano ride
- Ringing the changes
- I like to move it, move it...
- Gentlemen, we can rebuild yeast. We have the technology…
- It's a kind of magic
- Crystal clear...
- Facing up to fullerenes
- Mind if I cut in?
- ACS: The Devil went down to Georgia...
- ACS: All features great and small
- ACS: Under pressure...
- ACS: Uncomfortably numb
- ACS: Blogs plugging blogs on blogs
- ACS: If I had a million dollars...
- ACS: The Imperiali Code
- ACS: Groove is in the Hartwig...
- ACS: Nature is blog crazy!
- ACS: You spin me right round...
- ACS: Analytical chemistry goes to the clinic
- ACS: Fatal attraction
- ACS: Looking for data in all the right places...
- ACS: Highway to Heck...
- ACS: New kids on the block
- ACS: Why we do the things we do
- ACS: Writing tips from Whitesides
- ACS: A skeptical chemist
- ACS: The life aquatic with William Fenical
- ACS: Sweet home Atlanta
- Georgia on my mind….
- Let’s twist again
- Chemistry: the central science
- NPG at the 2006 Spring ACS meeting
- Planes, trains & nanomobiles
- I want a new drug...
- One ring to rule them all...
- I want my, I want my CNT TV
- Small talk
- Chutes and ladderanes...
- A special issue of Nature...
- What's in a name?
Search
Subscribe
Subscribe to this blog's feeds:
Categories
- Author
- Features
Recent Posts
- Reactions - Maitland Jones
- Tateshina 2009: Behind closed doors
- The role of referees
- Reactions - David Andrews
- How many elements have you used?
- Latest ChemPod online
- Nobel Laureate - Venki Ramakrishnan
- Materials Girl: Buried under a mountain of digital paperwork
- Reactions - Jonathan Sweedler
- And the winner is...
Recent Comments
Out of 1046 total comments,
the most recent were:
the most recent were:
Archives
- November 2009
- October 2009
- September 2009
- August 2009
- July 2009
- June 2009
- May 2009
- April 2009
- March 2009
- February 2009
- January 2009
- December 2008
- November 2008
- October 2008
- September 2008
- August 2008
- July 2008
- June 2008
- May 2008
- April 2008
- March 2008
- February 2008
- January 2008
- December 2007
- November 2007
- October 2007
- September 2007
- August 2007
- July 2007
- June 2007
- May 2007
- April 2007
- March 2007
- February 2007
- January 2007
- December 2006
- November 2006
- October 2006
- September 2006
- August 2006
- July 2006
- June 2006
- May 2006
- April 2006
- March 2006
Related Links
-
- Click this link to view NPG's Chemistry Portal
- Journals
- Nature
- Nature Chemical Biology
- Nature Materials
- Nature Methods
- Nature Structural & Molecular Biology
- Nature Reviews Drug Discovery
- Nature Nanotechnology
- Blogroll
- A Chemist's Laboratory Notebook
- A Chemical Sabbatical
- A Synthetic Environment
- Carbon-based Curiosities
- Carbon Tet
- C&ENtral Science
- Chem-bla-ics
- Chemistry Blog
- Chemistry World Blog
- Everyday Scientist
- FemaleScienceProfessor
- In The Pipeline
- Jungfreudlich
- Milo Muses
- Molecule Of The Day
- Nanoscale views
- On the Road
- Org Prep Daily
- Organometallic Current
- Periodic Tabloid
- Peter Murray-Rust's Blog
- Lecturer Notes
- Sciencebase
- Soft machines
- The Chem Blog
- The Culture of Chemistry
- The Curious Wavefunction
- Totally Synthetic
- Useful Chemistry
Powered by
Movable Type 3.2
Movable Type 3.2
