nature.com
homepage
The Sceptical Chymist
Reactions - Maitland Jones
Tateshina 2009: Behind closed doors
The role of referees
Reactions - David Andrews
How many elements have you used?
Latest ChemPod online
Nobel Laureate - Venki Ramakrishnan
Materials Girl: Buried under a mountain of digital paperwork
Reactions - Jonathan Sweedler
And the winner is...
Reactions - Jason Chin
The shameless annual Nobel Prize speculation post
Materials Girl: Upwards and onwards
Reactions - Joost Reek
Reactions - Laura Croft
A reprieve for Cp?
Podcast, videos and more!
Reactions - Lisa McElwee-White
Nobel reactions
Reactions - Scott Mabury
ACS: Organic highlights
ACS: Afternoon with the chain gang
ACS: Nanopower
ACS: Beginning to see the light
ACS: Open to ideas
ACS: Pressurized preservation
Reactions - George Stanley
Reactions - Ann Valentine
IUPAC '09: Magical molecular machines
IUPAC '09: Thinking big to save the world
IUPAC '09: Save the symbol!
IUPAC '09: Chemistry in the main (group)
IUPAC '09: posters and pink wine
IUPAC '09: Carbon capture conundrums
IUPAC '09: Tweet tweet!
IUPAC '09: Livin' La Vida Loca
IUPAC '09: Patenting bacteria
IUPAC '09: Nanofun and marvellous MOFs
IUPAC '09: Strontium sticks
IUPAC '09: Mapping methanol in space
IUPAC '09: saving the planet one atom at a time
Reactions - Zachary Aron
Putting the chemistry into sci-fi: Episode 3
Putting the chemistry into sci-fi: Episode 2
Materials Girl: Catching up
Putting the chemistry into sci-fi: Episode 1
Reactions - Kalai Saravanamuttu
Reactions - Aaron Wheeler
Educating Excimer: Room to fail
Welcome to the periodic table Copernicium!
Reactions - Nick Fisk
Long time, no blog
Reactions - Ian Fleming
Lindau09: Twitter round-up #4
Lindau09: Island hopping
Lindau09: Twitter round-up #3
Lindau09: And now for something completely different
Lindau09: Reflections on day 2
Lindau09: Twitter round-up #2
Lindau09: Art meets science
Lindau09: Twitter round-up #1
Lindau09: Setting the scene
Showing their metal
Reactions - Lei Zhu
Chemists take on immunology
I love Paris
On the road again
Reactions - Richmond Sarpong
Reactions - Aaron Wright
Educating Excimer: The End of the 'Cookbook' Lab
Reactions - Carolyn Bertozzi
Editorial: Beyond the printed page
Reactions - Erin Carlson
Materials Girl: Expectations
Reactions - Eugenio Coronado
The RSC and ChemSpider
Materials Girl: Readjusting
Reactions - Ross Kelly
Reactions - Kristopher McNeill
Nature Chemistry issue 2 - live today
Reactions - Alán Aspuru-Guzik
Chempod: DNA litmus test and ACS round-up
Reactions - Shana Kelley
SciFinder and the small screen
MRS: A good start
Reactions - Ted Sargent
Outsell and InChIs
Materials Girl: Say, what?
Where does lithium come from?
Chemiotics: Chemists — masters of the Cartesian dualism
Reactions - Jonathan Clayden
Out and about in Japan
Reactions - Andrew Dove
ACS: Good to the last drop
ACS: Press here
ACS: How much do you want?
ACS: Cells are weird
JACS on your phone...
ACS: How sweet it is...
ACS: I went to SLC and all I got was...
ACS: The mountains are to the
east
...
Nature Chemistry, volume 1, issue 1
Reactions - Stuart Cantrill
Chemiotics: Binding physicality rather than chemicality
Materials Girl: How time flies
Reactions - Jacob Klein
It's all going on...
Reactions - Xueming Yang
Chemist challenged
Microtubes on YouTube
Reactions - Andrew Weller
ChemPod continues...
Chemistry countdown complete
NChem Research Highlights: Nanotube electrocatalysts, pentagonal prisms and corroding platinum
Reactions - David Cahen
A chemistry prescription
Chemist's choice
NChem Research Highlights: Total synthesis, boron boride and sensor arrays
Reactions - Nicholas Long
Spinning out
Sugar Daddy: Not so boron after all
NChem Research Highlights: Catalysis, catenanes and qubits
Chemiotics: The further uses of redundancy
Reactions - Lynn Loo
NChem Research Highlights: Polymers, magnets and suprabowls
Reactions - Rachel O'Reilly
Science in trouble
My little black book
NChem Research Highlights: π interactions, field-effect transistors and ion recognition
Reactions - Yun-Bao Jiang
Learning to learn again
Chemiotics: The death of the synonymous codon
NChem Research Highlights: Straight iron, protein binding and H-graphene
Reactions - Paul Plieger
NChem Research Highlights: Cheap fuel cells, biopolymer threading and biosensors
Reactions - Graeme George
Reactions - Julie MacPherson
Reactions - Luisa De Cola
Materials Girl: The bell curve doth toll
NChem Research Highlights: Biosensing dyes, strong biomimics and levitating beads
Reactions - Ivan Dmochowski
Top 10 Research Highlights of 2008
All I want from Santa...
They'd none of them be missed – why 20 amino acids and not 15?
Crosspost: What element do you want for Christmas?
NChem Research Highlights: Chiral alcohols, entrapment and nanotube motors
Reactions - Hilary Crichton
Free News & Views!
The Sceptical Twitterer?
NChem Research Highlights: Bryostatin, dendrimers and rowing microparticles
Reactions - Cristina Lagunas
Materials Girl: Old school, new school
NChem Research Highlights: Twisting, diversity and order from disorder
Reactions - Rory Waterman
Sugar Daddy: Like sleeping with an elephant
NChem Research Highlights: Metathesis, omniphobes and di-iron
Reactions - Daniel Neumark
Credit crunching
Pimp my RSS
NChem Research Highlights: graphene, the chemistrode and hypervalence
Reactions - Paul Kruger
Explain it to me
Journal journeys: Day 285, Relocation, relocation
NChem Research Highlights: BO, drag and knotty molecules
Reactions - Andrew Wilson
Oooh! Aaaah!
NChem Research Highlights: layering liquids, double metallocenes and fixing fingerprints
Reactions - Dongyuan Zhao
Chemiotics: Sherlock Holmes and the Green Fluorescent Protein
Hic!
Materials Girl: Scientific debate
NChem Research Highlights: Bimetallic nanoparticles, oxo complexes and those blue bananas
Bumper ChemPod edition
Reactions - Daniel O'Leary
Journal journeys: Day 266, We're hiring!
System requirements
NChem Research Highlights: Bidentate ligands, squares and chirality
Reactions - Jean-Claude Bradley
NChem Research Highlights: Strain, MOF tags and a certain prize
Reactions - Cameron Neylon
Nobel Prize 2008
The science scoop
NChem Research Highlights: Oxonium, feedstocks and enzymes
Reactions - Anne Pichon
Look my way
Where's my Nobel fix?
Chemiotics: Auditing P-Chem
NChem Research Highlights: Ultracapacitors, nitrogen cleavage and applied asymmetric catalysis
Reactions: Saiful Islam
Materials Girl: Living with chemists
Ernest Eliel
RSC Roadmap
NChem Research Highlights: Organo-photo-catalysis, funny fullerenes and anti-freeze proteins
Taking solace in synthesis?
Reactions - Michaele Hardie
Double the fun??
NChem Research Highlights: Ion transport, f-block ionic liquids and gold catalysis
Reactions - Jun Okuda
Alphabet of elements
NChem Research Highlights: Paper devices, T-jumps and defluorination
Chempod: Going green
Reactions - David Milstein
Materials Girl: Flights of fancy
Chemiotics: Apologies to Borodin
NChem Research Highlights: Patterning, MOFs and ligands
Reactions - Anna Balazs
NChem Research Highlights: Mars, mass spec and metals
Reactions - Judy Kim
ACS: Philadelphia 2008 - Love Train
ACS Philadelphia 2008: Something to "Chu" on
ACS Philadelphia 2008: Escaping the conference
ACS Philadelphia 2008: When will cheap solar power become reality?
ACS - Picture this
ACS Philadelphia 2008: On the presidential campaign trail
ACS Philadelphia 2008: The Boss
ACS Philadelphia 2008: Phys Chem heavyweights
ACS - Neuro-logical
ACS Philadelphia 2008: Viruses make batteries
ACS - Thanks for the memories
ACS Philadelphia 2008: Posters...
ACS Philadelphia 2008: Bad luck strikes - twice
ACS Philadelphia 2008: Big talk
ACS Philadelphia 2008: Trees eat pollution
NChem Research Highlights: Fullerenes, opalescent arrays and hydrogels
ACS - Movie stars
Angstrom olympics!
ACS Philadelphia 2008: Board
ACS - Chemistry issues
Reactions - Catherine Murphy
You put your left hand in...
NChem Research Highlights: Natural products, light-harvesting and water-splitting
Reactions - Neil Withers
Journal journeys: Day 189, Paper trail
Materials Girl: Delays
NChem Research Highlights: Arenes, rotaxanes and rotors
Reactions - Omar Yaghi
Factoring in a sweet tooth
Journal journeys: Day 179, Picture this...
NChem Research Highlights: carborane MOFs, metal-ion sensing, and coordination polymers
Reactions - Ronald Breslow
ICCC38: Coordination chemistry
NChem Research Highlights: Isotopes, proteins and reactive intermediates
Flown the coop
Reactions - Gavin Armstrong
Who’s the greatest Russian (scientist)?
Seeing single atoms in a TEM
Belgian BOSS
Chemiotics: Unrequired reading
Periodic Table of Videos
Materials Girl: Comparisons
NChem Research Highlights: Ionic liquids, electronic noses and tuning tubes
Reactions - Heather Maynard
Materials Girl: Silence speaks for itself
NChem Research Highlights: Self-healing coatings, bacterial inhibitors and single-molecule magnets
Reactions - Stephen Davey
DD11: Stanford and Scripps
NChem Research Highlights: total synthesis, multimetallic complexes, and photoresponsive elastomers
Reactions - Aline Miller
Amazing green moving light thingy. It's chemistry!
ChemPod 6
DD11: Main group rennaisance
Take me to your... workplace
NChem Research Highlights: cell metabolites, chocolate, and hydrogenation catalysis
Reactions - Harry Kroto
Non-deep thoughts by Catherine Goodman
Chemiotics: A chemical double entendre
Reactions - Cameron Alexander
NChem Research Highlights: stereochemistry, switches and molecular electronics
Name that tune in three elements
Sugar Daddy: The importance of being... there
Journal journeys: Day 132, Out and about
¡Gol!
NChem Research Highlights: superconductivity, protein folding and cross-coupling
Reactions - Polly Arnold
Chemiotics: A chemical gedanken experiment
Reactions - Francesco Stellacci
NChem Research Highlights: capsules, spectroscopy and nanomachines
Dodge this.
Reactions - Marty Burke
NChem Research Highlights: silenes, cortistatin and magnetic beads
JACS 2.0
The platypus as inspiration
Reactions - Penny Brothers
NChem Research Highlights: viscosity, nanotrees and solid-state synthesis
Chemiotics: Do you know where your drug is (and what it is doing)?
Materials Girl: A watched TLC plate never rises
Prospective Professor: The Beginning After the End
Reactions - Arata Yajima
NChem Research Highlights: Hydrogels, viral mimics and helical foldamers
JJ: Day 98, Service with a 'Simplified Molecular Input Line Entry Specification'
Chemiotics: Why should a (biological) protein have one shape?
NChem research highlights: Buckyballs, self-assembly and antitumour agents
Reactions - Molly Shoichet
Diamond studies...on diamond
First impressions
Birth of a legend?
Death of a legend
Sex and the chemist
Reactions - Donald Tomalia
Nature Chemistry research highlights
Journal journeys: Day 84, Team Chemistry
I'd like to teach the world to do a perfect TLC...
Chemiotics: Why should a protein have one shape?
ChemPod 5
Here comes the judge
Reactions - Martin Schröder
Rookie Rocky: Establish your own brand
Journal club - Marty Burke
Materials Girl: The science of appliance
Chemiotics: How many proteins can we make?
Reactions - Toshimi Shimizu
ACS: Flight of fancy
ACS: While stocks last...
ACS: Picture this
ACS: Big, but certainly not easy...
Reactions - Barney Grubbs
Materials Girl: Questions...
Chemiotics: Causality in the cell and how puppies give us hope
Communication let me down
A burner by any other name...
Reactions - Phil Gale
Beating nature to save the planet
Journal journeys: Day 54, Housekeeping
Reactions - Gary Siuzdak
Chemiotics: The vanishing simplicity of chemical pathways in the cell
I've got the whole issue in my hands...
Reactions - Tom Welton
Materials Girl: Then and now
Chemiotics: The decline of the master gland and the rise of feedback
I (don't) believe in miracles
Sugar Daddy: This chemical reaction was brought to you by...
The more things change, the more they stay the same...
Reactions - Maurizio Prato
How to disappear completely
Chemiotics: Is math harder than organic chemistry?
Holy science, Batman!
CFCs: What is right?
In a spin
Nice work if you can get it?
Reactions - Ben List
Prospective Professor: Decisions, Decisions, Decisions
Chemiotics: The unbearable weirdness of quantum mechanics (with apologies to Kundera)
Journal journeys: Day 25, First contact
Rookie Rocky: Show me the money!
Open chemistry
Reactions - One year old today!
Journal journeys: Day 21, Cover story
Chemiotics: We had to destroy the village to save it
Materials Girl: To sheet or not to sheet
Charge complete
Journal journeys: Day 18, Objecting to objectives
President of What?
ChemPod 4
Reactions - Stuart James
Chemiotics: Introduction and allegro
Journal journeys: Day 14, Driven to distraction
Chemistry
in fantaseo
(You make me feel like) a chemistry professor
Hard times for rubber farmers
Reactions - Carsten Schmuck
Journal journeys: Day 1, Swamped!
Reactions - Tony James
Bringing something new to the table
Journal journeys: Day -2, The long and short of it
Flat-out carbon
Where the chemistry has no name
Reactions - Angel Kaifer
Journal journeys: Day -8, The colour of chemistry
Materials Girl: Aftermaths
Journal journeys: Day -11, Deadline day
Reactions - Eric Scerri
Game on!
Prospective Professor: On the road again
I've got you under my skin
Reactions - Harry Gibson
Mercury rising (from the dead)
The world of nano at your fingertips...
Takin' care of business
Reactions - Howard Colquhoun
Reactions - Younan Xia
Reactions - Steve Nolan
Materials Girl: The end product
The (not so) secret lives of chemists
Here fishie, fishie, fishie...
Reactions - Taeghwan Hyeon
Now I’m cookin’
Materials Girl: Procrastination...
Sugar Daddy: HPLC, I'm stuck on you
Reactions - David K Smith
Ion awe
Degraded by the light
War... what is it good for?
The old ones are always the best
Reactions - Klaus Theopold
Prospective Professor: The Employment Pages
Rookie Rocky: About teaching
Reactions - Paul Low
Materials Girl: Why not?
Nature Chemical Biology is coming to town
Reactions - Frank van Veggel
ChemPod the third
Reactions - Neil Champness
Interview with a chemist
I'll be the judge of that...
Reactions - Ben Davis
Sugar Daddy: Do not pass ‘Go’, do not collect $200
Chemical showers
Chemical communications
Materials Girl: Synthetic limericks
Reactions – Simon Webb
Chemistry for chemistry's sake
Art for chemistry's sake
I believe that children are our future
Reactions – Mark Green
Rookie Rocky: A Tale of Two Sciences
Prospective Professor: Against All Odds
Nano prizes
Reactions - Jeroen Cornelissen
Did you hear the one about nanotechnology and football...
Eyes on the prize
Materials Girl: Moving up
Reactions – Steve Marsden
Materials Girl: Moving around
Materials Girl: Moving in
Under the gun
Reactions - Duncan Bruce
Focusing in on mass spectrometry
Sugar Daddy: Looking both ways
Imaging is dino-mite!
Someday we'll all be free
Reactions - Milo Shaffer
Six degrees of Stuart Schreiber
Time, time, time
Structurally unsound
Reactions - Marcus Weck
10 Miles from Academia: The Cost of Independence
No prizes for guessing...
Fear and loathing
Rookie Rocky: A rookie “business-class” passenger in a seminar room
Materials Girl: Whatever can go wrong, will...
CFCs: So do I miss being a chemist?
Reactions - Rein Ulijn
A little quiz
ChemPod 2
News from Nature Protocols
Reactions - Peter Cragg
I've got my spine...
Materials Girl: Physics, summer school, and math – oh my!
Reactions - Mary Cloninger
ACS: The party's over
ACS: Homecoming
ACS: Friends reunited
ACS: Worms
ACS: Hot secrets
ACS: Marbles, I've lost mine
ACS: Factoids
ACS: Time's (nearly) up
ACS: Strictly ballroom
ACS: In my opinion, the drug is ready
ACS: Avogadro's out
ACS: In the best possible taste
ACS: So long, and thanks for all the fish
ACS: Katharine the gourmand
ACS: Hello... Are there any bloggers out there?
ACS: When will I learn
ACS: Analyse this
ACS: Hydrogen hiccups
ACS: Poets corner
ACS: Going the distance
ACS: News hound arrives at last
ACS: It's better to travel...
ACS: Here I go again
Reactions – S. Thayumanavan
North by Northwestern
Nobelium - No!
Nature Chemistry
Materials Girl: A quick thought
Totally natural
CFCs: What makes a good presentation?
Hail to the Chief
Materials Girl: An introduction
Reactions - Len MacGillivray
Doctor who?
You say tomato...
Reactions - Darren Hamilton
My dry box is still better than your dry box
Enzymes, macrocycles, and fluorescent dyes, oh my!
For screening purposes only
Reactions - Pavel Anzenbacher
I heart chemistry
My dry box is better than your dry box
Doin' what comes naturally
Reactions - Lee Cronin
Talk talk
Glasses, glasses everywhere, but not a drop to drink
No room at the inn
Reactions - Heather Carlson
CFCs: Bingo!
Now you see 'em...
Badly drawn bonds
Reactions - Stuart Rowan
Fireworks come alive! ALIVE!!!
Podcast killed the radio star
I can't live without my radio...frequency pulse
Reactions - Glen Miller
I'm into something good
Fashion
Whiskey in the jar
The NIHghts who say 'no'
Reactions - Catherine Goodman
In the Summertime
CFCs: Confessions of a former chemist
Man in the mirror (on the moon)
Outnumbered
Chemical biology, au naturale?
Respect
Reactions - Joshua Finkelstein
A knight's tale
Oh happy day
Reactions - Miguel Garcia-Garibay
Light up my life
Reactions - Andy Mitchinson
The weight
Reactions - Joe Sweeney
Singin' in the ... lab
They might be giants
Anarchy in the UK
It's economics, stupid
Living in a material world...
Reactions - Derek Lowe
Insane in the brain!
London calling
Gene genie
Crazy frogs
Nanotubes - Pasteurized!
I'd like to buy the world a Coke
Reactions – Nadrian Seeman
Ich muss einen Blog schreiben...
Reactions - John Anthony
The yellow (and red, blue and green) brick road
A nanotube fix
Endangered elements
Add it up
Reactions - Jonathan Steed
Pour some sugar on me
Who's the hardest of them all?
Reactions - Tom Muir
On the streets of Philadelphia
May Day comes early
50 ways to write a (cover) letter
Reactions - Shuguang Zhang
Pure and simple
Learning Japanese, I think I'm learning Japanese...
Very superstitious...
Reactions - Vince Rotello
Going postal
ACS: Slow writer (part 3), or, Go Phoenixes!
Roll with it
ACS: Slow writer (part 2), or, Nature will find a way...
Reactions - Mike Zaworotko
ACS: Slow writer (part 1)
ACS: It's over
ACS: Cold fusion anyone?
ACS: What happened today?
ACS: Crowded house
ACS: Caught in a trap
ACS: Hero worship
ACS: Take a walk on the wild side
ACS: Chemists, chemists everywhere and not a drop to drink
ACS: The wheels on the bus (don't move at all...)
ACS: milk is dairy, right?
ACS: Dean Martin tribute
ACS: Listen up kids, it could happen to you
ACS: Rage for the machine
ACS: Lost in space
ACS: I fought the law...
ACS: Like a virgin
ACS: My kind of town
ACS 2007 - Nature newsblog
NPG at the 2007 Spring ACS meeting
Reactions - Fraser Stoddart
Mechanical chemistry
Comin' atcha, NChB style
Making a list...
Reactions - AP de Silva
In the bag?
Reactions - James Tour
Don't know much about chemistry...
Back from hiatus...
The edges of our material world
Reactions - Bruce Gibb
Making sense of science
Porphyrin power
A bygone age
Reactions - David Leigh
Sparkly science
Go nuclear?
What's black and white and read all over?
People are people, so why should it be...
Anything you'd like to share?
Time is on my side
I've got the power
A cluster of chemists(?)
Labspeak, STAT
Soft science
Day TRP-per
The devil is in the details...
Demons lurking
(Your love is like) bad medicine
DIY Drug Discovery
Tubulin is red, violets are blue, isofagamine is sweet, and so are you!
Heard that talk about short'nin' bread?
Nano pants!
Feeling hot, hot, hot!
New nano knight
And the award goes to...
The J-factor
Click click bang bang
My own, personal, Mr. Roboto
Next week's Novartis symposium...
Feedback loop
It’s Greek to me!
Giving the gift of drugs
If you don't eat yer meat, you can't have any pudding...
Say it with flours
Insane in the membrane!
Talk talk
A false economy
All the small things
Nobel update
The Hunt for Read October
Better late than never...
I left my phone in San Francisco
Grand theft auto: Levinthal paradox city
The Stockholm syndrome
ACS: The Rainbow Connection
ACS: Poly want an enzyme?
ACS: Sittin' on the dock of the bay
ACS: butternut squash soup
ACS: Conference bon bons
ACS: Clicking and beeping
ACS: Sweet surrender
ACS: All that glitters is gold
ACS: I love technology
ACS: Mongolian Licorice
ACS: Nobel laureate book club
ACS: Against "molecular gastronomy"
ACS: Ah, high culture
ACS: Fuelmen
ACS: Big in America
Goin' back to Cali
It's not easy being green
NPG at the 2006 Fall ACS meeting
Sympathy for the chemist
I still haven't found what I'm looking for
European Chemistry Congress: Viszontlátásra
European Chemistry Congress: Gold medal
European Chemistry Congress: Quite a jar
2 + 2 = 5
European Chemistry Congress: Bon bons of interesting chemistry
Turn on, tune in, kill cells
Su Doku goes periodic
European Chemistry Congress: Chemical Darwinism
European Chemistry Congress: I heart food chemistry
A bottle of red, a bottle of white
European Chemistry Congress: Panacea in the water?
European Chemistry Congress: more blogging from Budapest.
European Chemistry Congress: the reception
European Chemistry Congress: Jó napot kívánok
Come together
The right chemistry
Endosymbiotic by nature
Snakes on a Protein
Almost Famous
Fame (I'm gonna live forever...)
The big picture
The best of what’s around
A chilling end
The incredible shrinking lab
GRC: Ice ice baby
A penny for your thoughts
Toxins are busting out all over
Don't sweat the small stuff
Growing pains in chemical biology
Bring on the beer
Nature Protocols
Save the date
Don't call it a comeback...
We gotta get out of this place
On the ball
Bruce Merrifield
Twisting the night away
You down with NNB? (Yeah you know me...)
OK Computer
It's all about the Benjamins
Summertime
The safety dance
The days of wine and cheeses
Everything bad is good again
Video killed the radio star
Where's the magic gone?
Happy birthday, Nature Chemical Biology!
Hot stuff
Ask an expert
I am the Lorax. I speak for the trees...
Carry On Chemistry
Doing the worm...
TCTTGTGAACCTACTATTTGTGCTCTTTGTCATTATATGATTTCTACT
Why did the chicken cross the road?
Bucking bucky beliefs
And the Oscar goes to...
Of global warming and hurricanes
Pimp my nano ride
Ringing the changes
I like to move it, move it...
Gentlemen, we can rebuild yeast. We have the technology…
It's a kind of magic
Crystal clear...
Facing up to fullerenes
Mind if I cut in?
ACS: The Devil went down to Georgia...
ACS: All features great and small
ACS: Under pressure...
ACS: Uncomfortably numb
ACS: Blogs plugging blogs on blogs
ACS: If I had a million dollars...
ACS: The Imperiali Code
ACS: Groove is in the Hartwig...
ACS: Nature is blog crazy!
ACS: You spin me right round...
ACS: Analytical chemistry goes to the clinic
ACS: Fatal attraction
ACS: Looking for data in all the right places...
ACS: Highway to Heck...
ACS: New kids on the block
ACS: Why we do the things we do
ACS: Writing tips from Whitesides
ACS: A skeptical chemist
ACS: The life aquatic with William Fenical
ACS: Sweet home Atlanta
Georgia on my mind….
Let’s twist again
Chemistry: the central science
NPG at the 2006 Spring ACS meeting
Planes, trains & nanomobiles
I want a new drug...
One ring to rule them all...
I want my, I want my CNT TV
Small talk
Chutes and ladderanes...
A special issue of Nature...
What's in a name?
Search
Search this blog:
Subscribe
Subscribe to this blog's feeds:
Blog Posts
Blog Posts with Comments
[
What is this?
]
Categories
Author
Andrew Mitchinson
Catherine Goodman
Gavin Armstrong
Joshua Finkelstein
Katharine Sanderson
Neil Withers
Other Authors
Stephen Davey
Stuart Cantrill
Features
Chemiotics
Conference reports
Confessions of a former chemist
Educating Excimer
Journal Club
Journal journeys
Materials Girl
NChem research highlights
Other Columns
Prospective Professor
Reactions
Rookie Rocky
Sugar Daddy
Recent Posts
Reactions - Maitland Jones
Tateshina 2009: Behind closed doors
The role of referees
Reactions - David Andrews
How many elements have you used?
Latest ChemPod online
Nobel Laureate - Venki Ramakrishnan
Materials Girl: Buried under a mountain of digital paperwork
Reactions - Jonathan Sweedler
And the winner is...
Recent Comments
Out of 1046 total comments,
the most recent were:
Will
on
How many elements have you used?
Neil
on
How many elements have you used?
Katherine Haxton
on
How many elements have you used?
Derek Lowe
on
How many elements have you used?
T. P. Radhakrishnan on
A reprieve for Cp?
Archives
November 2009
October 2009
September 2009
August 2009
July 2009
June 2009
May 2009
April 2009
March 2009
February 2009
January 2009
December 2008
November 2008
October 2008
September 2008
August 2008
July 2008
June 2008
May 2008
April 2008
March 2008
February 2008
January 2008
December 2007
November 2007
October 2007
September 2007
August 2007
July 2007
June 2007
May 2007
April 2007
March 2007
February 2007
January 2007
December 2006
November 2006
October 2006
September 2006
August 2006
July 2006
June 2006
May 2006
April 2006
March 2006
Related Links
Click this link to view NPG's Chemistry Portal
Journals
Nature
Nature Chemical Biology
Nature Materials
Nature Methods
Nature Structural & Molecular Biology
Nature Reviews Drug Discovery
Nature Nanotechnology
Blogroll
A Chemist's Laboratory Notebook
A Chemical Sabbatical
A Synthetic Environment
Carbon-based Curiosities
Carbon Tet
C&ENtral Science
Chem-bla-ics
Chemistry Blog
Chemistry World Blog
Everyday Scientist
FemaleScienceProfessor
In The Pipeline
Jungfreudlich
Milo Muses
Molecule Of The Day
Nanoscale views
On the Road
Org Prep Daily
Organometallic Current
Periodic Tabloid
Peter Murray-Rust's Blog
Lecturer Notes
Sciencebase
Soft machines
The Chem Blog
The Culture of Chemistry
The Curious Wavefunction
Totally Synthetic
Useful Chemistry
Links
PubChem
IUPAC
ChEBI
Chemical Blogspace
Chemical Forums
Chemical Glossary
ETH's Experiments on the web
Societies
Royal Society of Chemistry
American Chemical Society
Chemical Society of Japan
European Association for Chemical and Molecular Sciences
European Network for Chemistry
Federation of Asian Chemical Societies
The Chemical Institute of Canada
German Chemical Society (GDCh)
Powered by
Movable Type 3.2