Main

February 15, 2008

President of What?


If you're living in the United States (or if you're following the race to the White House from another country/overseas), you've probably noticed that - while the presidential candidates have talked about a broad range of important issues - they haven't spent a great deal of time discussing scientific topics/science policy... You might be interested to learn that ScienceDebate2008.com, a grassroots organization, has been calling for - and has apparently now organized - a presidential debate on science and technology.

While it's not clear which presidential candidates will attend the debate (April 18th in Philadelphia), I think it could be pretty interesting: science/scientific policy is certainly not the most important issue for many Americans, but I'd personally like to learn more about the candidates' positions on funding, scientific education, and some of the other topics listed on the ScienceDebate2008.com website.


I've been thinking about this topic for a few days, and I've come up with a few questions I thought I'd throw out to our readers:

What scientific issue(s) could potentially swing your vote one way or another? For example, could you vote for someone who didn't 'believe' in evolution, or would that be an instant 'thumbs down'? What about a candidate who mandated that abstinence-only programs were the only kinds of sexual education allowed in public junior high/high schools? What 'hot button' issue is so important to you that it would cause you to re-think who will get your vote?

With that in mind, what question (or questions) do you think need(s) to be asked during this debate for it to be useful to the scientific community? Should a prominent scientist be asked to co-host the debate? If so, who has the intellect and the charisma to do it (well)?

Let's say you won the election and were going to be the next president. What big (science-related) changes/initiatives would you make/fund in your first year in office? For example, would you try to double the NIH and/or NSF budget(s) over the next five years? Maybe you would boost NASA's budget so that we can put a man/woman on Mars in our lifetime? Would you cut back on research related to bio-terrorism or spend more on this topic? (For the sake of this discussion, let's assume that you're so popular/persuasive that you could convince any relevant governmental bodies to do whatever you recommended...)

Looking forward to hearing your thoughts!

Joshua


Joshua Finkelstein (Senior Editor, Nature)

January 04, 2008

Takin' care of business


Happy new year to everyone! I hope you were all able to take off a few days from lab-work/school-work/work and catch up on sleep, read a few good books, and decompress a bit...

It's been a long time since I've blogged, but I just wanted to tell you some great news - I'm very happy to announce that Stuart Cantrill will be the chief editor of Nature Chemistry (set to launch in early 2009)...

Some of you may have noticed that NPG is now searching for editors to join Stuart at Nature Chemistry, as well as a chemistry editor to take his place at Nature Nanotechnology...

If you have any questions about what life is like as an editor, please feel free to post it here and one (or more) of us will let you know our thoughts...

Hope you all had a great break!

Joshua


Joshua Finkelstein (Senior Editor, Nature)

October 22, 2007

I believe that children are our future


I only have time for a quick post, as I'm about to run off to a meeting - but I was in a baby gear/toy store yesterday, and I'm sorry to report that the children's chemistry sets were in the "Science & Magic" section.

That pairing really threw me for a loop - I guess any sufficiently advanced technology really is indistinguishable from magic...

Joshua


Joshua Finkelstein (Senior Editor, Nature)

August 22, 2007

ACS: In my opinion, the drug is ready


Like Catherine, I'm a bit behind on scientific posts - so here's a quick recap of some of the talks I attended earlier in the week.

My Sunday morning started with an excellent session on malaria/anti-malarials - Solomon Nwaka from the World Health Organization's Special Programme for Research and Training in Tropical Diseases 'kicked off' the session with a broad overview that really drove home why malaria is (still) such an important disease: every 30 seconds a child dies from malaria, and the disease is responsible for more that one million deaths each year. Anti-malarial drug resistance is a huge problem (and there aren't that many new drug candidates in the pipeline), so the session focused on several academic scientists who are searching for new drug candidates. This is often done as a collaboration with Medicines for Malaria Venture, a non-profit organization created to “discover, develop and deliver new antimalarial drugs through public-private partnerships.” (For more information on public-private partnerships, click here and here).

I was only able to stay for the first half of the session, but I heard Jonathan Vennerstrom talk about synthetic peroxide anti-malarials (including this simplified analog of artemisinin) and Paul O'Neill talk about analogs of amodiaquine that were active against drug-resistant strains of malaria (click here for a recent review on 4-aminoquinoline anti-malarials).

The debate about whether or not academic scientists should try to get involved in drug discovery can get quite heated (see Derek Lowe's take on it here; you might also be interested in this NRDD 'Outlook'). Though I understand why some scientists think that academics should avoid this area of research, many pharmaceutical companies aren't willing (or able) to pursue a drug discovery program that focuses on malaria or other important, yet neglected, infectious diseases that disproportionately affect developing countries. (NITD and GSK are important exceptions to this general rule...)

So my question is if many pharmaceutical companies aren't willing/able to tackle these problems, why shouldn't academic groups give it a try?

Joshua


Joshua Finkelstein (Senior Editor, Nature)

August 21, 2007

ACS: Hello... Are there any bloggers out there?

I only have time for a quick post, but I wanted to mention a few other blogs/bloggers that are at the fall ACS meeting - most of you know that Paul and Kyle are here, but it looks like journalists from C&EN and Chemistry World are blogging from the meeting (including Carmen Drahl, who used to post at She Blinded Me with Science/who now works for C&EN...)

It also looks like Mitch (from Chemical Forums) and Eric (from Homebrew and Chemistry) are here too... Have I missed anyone? If so, please add a link to their (or your) blog in the 'comments' section of this post...

It sounds like some of these bloggers will be at John Harvard’s Brew House in Harvard Square tomorrow night. I'll try to swing by for a round (and will see if I can convince any of the other NPG editors to join me) - hope to see you there...

Joshua


Joshua Finkelstein (Senior Editor, Nature)

August 20, 2007

ACS: Going the distance


Space is big. You just won't believe how vastly, hugely, mind-bogglingly big it is. I mean, you may think it's a long way down the road to the drug store, but that's just peanuts to space.

This Douglas Adams quote was one of the first things that popped into my head when I entered the Boston Convention & Exhibition Center. Simply put, the building is huge: "516,000 square feet of contiguous exhibit space" with "3 exhibition halls each ranging in size from 162,000 to 184,000 square feet."

After looking at the floorplan, I realized that it would be pretty tough to rapidly hop from session to session - the convention center has two skybridges that you need to use if you're moving from the west side of the building to the east side of the building, so it can take 10 to 15 minutes to get from one session to another. This must be why the refrigerator in the press office was packed full of bottles of Gatorade/Powerade...

The first day of the ACS was great (more about the science in my next post), but I've yet to find a good place to grab coffee that doesn't have a huge line at all hours of the day - on my way to the afternoon session I saw people crowded around a table containing snacks and coffee. Alas, the giant drum of coffee was decaf! I saw another table further down the corridor, but it too contained only decaf coffee. Oh cruel world, why must you mock me so?

Joshua


Joshua Finkelstein (Senior Editor, Nature)

August 17, 2007

ACS: Here I go again


Well, the fall ACS meeting is nearly here - a few NPG editors will be attending the meeting (including myself), so don't forget to check back for daily updates...

I also wanted to mention that we've put together another special issue of Nature that will be distributed at the meeting - in this week's issue, there's a News Feature on metal-organic frameworks and several papers:

- Structure-based activity prediction for an enzyme of unknown function by Hermann et al. (click here for the News & Views)
- Vitrification of a monatomic metallic liquid by Bhat et al. (click here for the News & Views)
- A transglutaminase homologue as a condensation catalyst in antibiotic assembly lines by Fortin et al. (click here for the News & Views)
- Selection and evolution of enzymes from a partially randomized non-catalytic scaffold by Seelig & Szostak (click here for the News & Views)

If you're going to be at the meeting, don't forget to swing by the NPG booth (booth #434) to pick up free issues of Nature, Nature Chemical Biology, Nature Materials, Nature Methods, Nature Nanotechnology, and Nature Reviews Drug Discovery.

And last (but certainly not least), Paul thinks we should meet for "[d]rinks or dinner at a neutral location" - depending on where and when it is, I'll try to swing by (and bring along a few of the other editors...) Hope to see you there!

Joshua


Joshua Finkelstein (Senior Editor, Nature)

August 13, 2007

Hail to the Chief


It's been ages since I've posted, but I saw this news this morning and thought it'd be worth mentioning on the blog - the board of directors recently decided to continue Nature Publishing Group's foray into the chemical sciences, and has just announced that it is searching for a Chief Editor to launch Nature Chemistry:

Alongside the highest-quality original research, Nature Chemistry will cover news, commentary and analysis from and for the chemistry community, as well as striving to develop a voice that chemists care about. We require a dynamic Chief Editor who is able to develop, launch and establish Nature Chemistry as the essential publication for the chemistry community. The role will be based in NPG's Boston office.
Applicants must have a strong track record of research in a related discipline, as well as significant editorial and/or senior research experience. They must demonstrate a good understanding of the challenges faced by researchers in both academia and industry. This is a demanding and extremely stimulating role, which calls for a keen interest in the practice and communication of science. The successful candidate will therefore be dynamic, motivated and outgoing, and must possess excellent interpersonal skills. Applicants should include a covering letter stating their suitability for this post, as well as their salary expectations, a current CV and a statement (maximum 1500 words) that encapsulates their vision for the content, competitive position and longer-term development of Nature Chemistry.

Applications are due in a few weeks, so don't forget to mark your calendars if you're interested in this position... And best of luck to you if you decide to apply!

Joshua


Joshua Finkelstein (Senior Editor, Nature)

June 25, 2007

Whiskey in the jar


On Wednesday night (June 27th), Nature Network Boston will be hosting their first 'pub night' at Tavern in the Square (in Central Square, Cambridge). Corie Lok, the editor of Nature Network Boston, recently blogged about this event, which will be "your chance to meet other scientists from the Boston area, including other members of and bloggers on Nature Network Boston and a few people from Nature’s Cambridge office..."

The pub night officially starts at 6:30 PM, and I'll be there for an hour or so; I think Catherine said that she's planning on being there for a little while too. So if you're in Cambridge that night, please swing by and say 'hello.' Make sure you come early, as Corie's buying the first 30 people a free drink...

Hope to see you on Wednesday night!

Joshua


Joshua Finkelstein (Senior Editor, Nature)

June 22, 2007

The NIHghts who say 'no'


Apologies to our international readers for the U.S.-centric post, but the National Institutes of Health announced earlier today that PAR-07-353, a grant involving Cheminformatics Research Centers, has been canceled for "programmatic reasons." For those of you who haven't heard of the Cheminformatics Research Centers, they are part of the Molecular Libraries Roadmap Program (MLP), which is

an integrated set of initiatives aimed at developing and using selective and potent chemical probes for basic research ... [The MLP] was proposed to introduce high-throughput screening approaches to small molecule discovery, formerly limited to the pharmaceutical research industry, into the public sector... [and] is made up of the following major components: (1) access to a library of compounds (Molecular Libraries Small Molecule Repository); (2) access to bioassays provided by the larger research community; (3) support for the development of breakthrough instrumentation technologies; (4) access to a network of screening and chemical probe generation centers (MLPCN) where assays are screened and probe development is undertaken; (5) Pubchem, the primary portal through which the screening results of the MLPCN are made public and (6) the Cheminformatics Research Centers (CRCs) with multiple roles focused on high-level data analysis and dissemination with a focus on developing new understanding of the cellular processes (genes and pathways).

One reason why this is so surprising is because the grants were due next week (June 28th). I imagine the timing of this decision (and the decision itself) is bound to upset a number of people in this community, especially since many applicants were probably working around the clock to get their grant submitted before the (now non-existent) deadline...

Does anyone know more about this story or why the grant was canceled?

Joshua


Joshua Finkelstein (Senior Editor, Nature)

June 21, 2007

In the Summertime

(Editor's note: at the request of the GRC, this post has been removed.)

Joshua Finkelstein (Senior Editor, Nature)

June 15, 2007

Reactions - Joshua Finkelstein


[In lieu of profiles, the contributors to this blog have decided to do their own Reactions pieces...]

1. What made you want to be a chemist?

I was a bit of a ‘late bloomer’ when it came to chemistry: I didn’t own a chemistry set when I was growing up or run reactions in my garage. And I didn’t really enjoy high school chemistry classes (though I liked that feeling you get after successfully balancing a complex chemical reaction...) But I had an amazing AP chemistry teacher in high school, so I went into college with an open mind. When I got there, I was drawn to organic and biological chemistry: I thought it was so cool that a chemist could (design and) synthesize a biologically-active organic molecule that could be used to tease apart a complex cellular process or could be developed into a drug.

2. If you weren’t a chemist/Nature Editor and could do any other job, what would it be - and why?

Like Andy, I probably would have been a musician - I play drums, jazz piano, various percussion instruments, and sing a bit. (I’m trying to learn how to play guitar, but don’t think my fingers are the right length/shape - or maybe I just need to practice more?) I played in a few bands in graduate school (which really helped keep my spirits up when my chemistry wasn’t working), and I miss the feeling you get when you’re playing music with close friends in a dirty/dusty basement...

3. How can chemists best contribute to the world at large?

The simple answer is to work on an important scientific problem that isn’t being adequately addressed by other chemists - easier said than done, though... I guess an important question to constantly ask is "why am I doing this experiment/project?" As long as you know the answer to that question, then you are probably "contributing to the world at large" - if you can't think of a good/satisfying answer, maybe it's time to change projects?

4. Which historical figure would you most like to have dinner with – and why?

If I had to choose a scientist, I’d probably invite Linus Pauling or RB Woodward to dinner - I’d be interested in hearing what they think about all the things scientists have discovered in the last few decades. If I could choose any historical figure, I think I’d invite Oscar Wilde or John Coltrane – I imagine Wilde would be hilarious in person and I’d love to hear Coltrane talk about music and tell stories about the jazz scene in the 50s and 60s...

5. When was the last time you did an experiment in the lab - and what was it?

Several years ago – I can’t remember exactly what it was, but it involved DNA glycosylases...

6. If exiled on a desert island, what one book and one CD would you take with you?

I think I’d want to bring something I’d read before/knew I liked - so I’d probably go with Tolstoy’s Anna Karenina or Eco’s Foucault's Pendulum. As for music, I don’t think I could survive if I only had a single CD - does a mix CD count? If so, I'd burn one that had the second movement of Beethoven’s 7th Symphony, John Coltrane’s Giant Steps, Dizzy Gillespie’s A Night in Tunisia, Beck’s Tropicalia, Life In A Glass House from Radiohead’s Amnesiac and/or Morning Bell from Radiohead’s Kid A, Stevie Wonder’s Superstition, and a few other tracks… (Thank goodness for iPods…)

Joshua Finkelstein is a Senior Editor for Nature and a regular contributor to the Sceptical Chymist.

May 30, 2007

The weight


There's an interesting news piece over at news@nature.com that caught my eye - a team led by Helge Riemann at the Institute of Crystal Growth is trying to generate a 'pure' sample of crystalline silicon-28:

The new barbell-shaped crystal, which weighs 5 kilograms and was completed on 23 May by Riemann's team ... is nearly isotopically pure. It was made from Russian source material, whose silicon was 99.994% pure silicon-28.

A standard kilogram is currently calibrated using the "international prototype," which "was manufactured in the 1880s [from] an alloy of 90% platinum-10% iridium" and is housed in the Bureau International des Poids et Mesures in France. Over time, the loss and/or gain of atoms from the international prototype may have altered its weight - the news story suggests that it might be off by 0.1 milligrams/0.01% (but I couldn't find any additional information to verify that statement...)

Making this (two-million euro/2.7-million USD) piece of silicon was no easy task:

The researchers spent six months eliminating contaminating elements by repeatedly melting the silicon in an apparatus that does not touch the material. The resulting crystal is thought to contain one foreign atom to every 10 million atoms of silicon.

Talk about a pure sample...

Joshua


Joshua Finkelstein (Senior Editor, Nature)

May 18, 2007

Living in a material world...


I was out at the pub last night with a few other editors, and one of my colleagues mentioned that an editor from Nature Materials is leaving the company (and the country) - while she'll be definitely be missed by all, this means that Nature Materials is searching for a new associate editor to join their team:

We are particularly interested in applicants with expertise in bio-inspired, biomedical and biomolecular materials, but we would welcome applications from outstanding candidates in any area of materials science.
The ideal candidate should have a PhD and preferably postdoctoral experience with a strong research record. The successful candidate will play an important role in determining the representation of their field in the journal, and will work closely with the other editors on all aspects of the editorial process, including manuscript selection, commissioning and editing of Reviews and News & Views, and writing for the journal. A key aspect of the job is liaising with the scientific community through laboratory visits and international conferences.

If you're interested in the position (which will be based in the London office - with Stuart and Andy), you'll need to apply soon - applications need to be in by June 4th...

Joshua


Joshua Finkelstein (Senior Editor, Nature)

May 17, 2007

London calling


Every six months or so, I pop over to England to catch up with my colleagues in our London office (NPG's largest office). I love visiting this city, and it's not just because I get to use words like 'skint' and eat fantastic Indian food every night...

But I was thinking about how difficult it must be for people who move to a new country to start their Ph.D.s/post-docs/jobs - in addition to adjusting to a new lab/co-workers (which can be difficult even if you're working in a familiar city/country), you have to learn how things are done/how things work in your new environment. As trite as it sounds, so many things can be so different.

For example, I lived in London for two months when I started at Nature, and I'm embarrassed to say that I had to dig out the manual for my combo washer/dryer to figure out how to operate it. (I thought I was doing something wrong because my clothes never came out 100% dry - it turns out that the machine in my apartment didn't use heat to dry the clothes, just an extended spin cycle...) Even going to the pub can be problematic: we had a German post-doc in our lab who frequently forgot to bring his passport when we went out for drinks. Despite the fact that he was in his mid-30s (and clearly looked old enough to drink in the U.S.), he had a difficult time convincing waiters/waitresses to serve him without ID...

For those of you who changed countries when starting your Ph.D./post-doc/job, I was wondering what little differences were the most frustrating for you? And for those of you who are living in a city/country you know well, how do you help your new co-workers adjust to their new environment? (For example, I've heard that some schools/labs distriubte packets that contain local information, FAQs, etc. - are these useful/helpful?)

Joshua


Joshua Finkelstein (Senior Editor, Nature)

May 14, 2007

I'd like to buy the world a Coke

The office coffee machine broke down this morning, so I've been using Coca-Cola to fight off the postprandial dip. I rarely drink soda (aside from the occasional Cuba Libre), so I'm usually the last to know about (crazy) new kinds of soda. But there's a case of Diet Coke Plus in our office refrigerator - you might not have seen it in your local supermarket, but it's a new version of Diet Coke that contains several vitamins and minerals:

Each eight-ounce serving of Diet Coke Plus provides a good source of Niacin (vitamin B3), vitamins B6 and B12, zinc and magnesium (15% Daily Value [DV] for Niacin, B6 and B12, 10% DV for zinc and magnesium).

Great news, no? Now you don't have to take that pesky multi-vitamin every day. Just have a few cans of Diet Coke Plus and you'll be all set...

Not a fan of Diet Coke? Not a problem: PepsiCo is responding with the launch of Tava this fall, which will contain "vitamins B3, B6 and E, and chromium." (Chromium?)

I'm just waiting for them to combine soft drinks with OTC medication: "have a hangover and can't stay awake at your morning meeting? Try new Coke NSAID - it comes in two flavors: cherry aspirin and vanilla ibuprofen..." Yum...

Joshua


Joshua Finkelstein (Senior Editor, Nature)

April 24, 2007

Pour some sugar on me


In this week's issue of Nature, there's an Insight - a special collection of six or seven related review articles - on Glycochemistry & Glycobiology. In this particular Insight, there are seven review articles:

Chemical glycosylation in the synthesis of glycoconjugate antitumour vaccines from Galonic & Gin
Unusual sugar biosynthesis and natural product glycodiversification from Thibodeaux, Melancon, & Liu
Cycling of O-linked beta-N-acetylglucosamine on nucleocytoplasmic proteins from Hart, Housley, & Slawson
Glycan-based interactions involving vertebrate sialic-acid-recognizing proteins from Varki
Heparan sulphate proteoglycans fine-tune mammalian physiology from Bishop, Schuksz, & Esko
Exploiting the defensive sugars of HIV-1 for drug and vaccine design from Scanlan, Offer, Zitzmann, & Dwek
Synthesis and medical applications of oligosaccharides from Seeberger & Werz

There's also a paper from van Kasteren et al. (with a News & Views from Grotenbreg & Ploegh) describing a new chemical tagging approach that can be used to add multiple sugars to bare protein scaffolds (i.e., proteins that were over-expressed and purified from bacteria). (You may have also noticed Wang et al's paper in last week's Nature, so it looks like April may be the sweetest - and not the cruelest - month after all...)

As I wrote in the editorial that accompanies the Insight, scientists generally shy away from carbohydrates - I barely remember learning about them in my undergraduate years and spent little time thinking about them during graduate school. But now it seems like the field is exploding: everywhere you look there's an interesting paper about carbohydrate chemistry and biology.

So with that in mind, we've put together this collection of review articles to celebrate chemists and biologists working with carbohydrates... We hope you enjoy them!

Joshua


Joshua Finkelstein (Senior Editor, Nature)

April 19, 2007

On the streets of Philadelphia


You may have already seen this news story in C&EN about a recent trial in Philadelphia: Merisant (the company that produces Equal and NutraSweet) has sued McNeil Nutritionals (the company that makes Splenda) because Merisant doesn't think it's fair that Splenda's marketing campaign includes the phrase "made from sugar, so it tastes like sugar."

This is the kind of advertising campaign that makes most chemists cringe, and - though this may sound like a petty dispute between two rival companies - I think we need to hold companies accountable for exploiting the general public's lack of scientific knowledge. Unfortunately many people will think: Splenda is not sugar, but it is made from sugar - so it must be safe, right? (Wasn't palytoxin made from sugar?) Though this sort of ad campaign wouldn't work on many scientists, it certainly worked on the general public: "sales of Splenda were weak in 2001, when McNeil launched an ad campaign saying the sweetener is made from sugar and including the phrase 'but it's not sugar.'" Since then, "Splenda has eclipsed Equal in the lucrative artificial sweeteners market" - and it's not like Merisant can counter with an ad campaign, saying that Aspartame's "made from phenylalanine, so it tastes like phenylalanine"...

It should be an interesting trial, as it's bound to have "phalanxes of neurobiologists and chemists as expert witnesses." (As an aside, I guess that the answer to Stuart's question is 'a phalanx of chemists'...) And the best part is that it's a jury trial, so anything can happen...

Do you think they'll use voir dire to exclude people who prefer natural sugar or are loyal to one of the two brands? Maybe I should offer my services, as I'm pretty indiscriminant when it comes to sweetening my coffee...

Joshua


Joshua Finkelstein (Senior Editor, Nature)

April 16, 2007

50 ways to write a (cover) letter


Kyle's blog entry on writing scientific papers got me thinking about an important - and underappreciated - part of submitting your work to a journal. So I thought I'd write down a few of my thoughts about cover letters. A caveat, of course, is that these are just my opinions - maybe other NPG editors can chime in and let me know if they agree/disagree with the items on this list...

1. You don't need to discuss much, but always submit a cover letter (unless the journal doesn't allow it) - I obviously can't speak for editors at other journals, but I always read the cover letter. It's often the first thing an editor reads, so don't miss out on a chance to make a good impression.

2. You don't need to be coy, Roy - the cover letter should contain a brief summary of the work, but be careful not to over- or underplay the discovery. If there are other key papers that have been recently published (i.e., this work refutes the model proposed in that paper), then point them out in the cover letter too - this part of the letter can be used to put your work into a broader context and highlight certain aspects that were unexpected/surprising.

3. Eschew obfuscation, espouse elucidation - it's fine to assume the reader is a Ph.D.-level scientist, but I think it's worth remembering that they may not be intimately familiar with every detail of your particular system. For this reason, I think it's worth taking the time to highlight the main points/the major implications of the work (see #2, though) without getting too bogged down in the technical details. If it's the first time anyone's shown X, then that's worth highlighting - just don't forget to explain why X is so important...

4. Eats, Shoots & Leaves - Microsoft Word's spell-check can be very helpful, but I think it's worth asking someone outside of your immediate field to read through your cover letter (and paper) to see if they notice any spelling/grammatical errors or confusing sentences/paragraphs. (But don't get too worried - you don't need to buy a Chicago Manual of Style to write a good cover letter...)

5. If you've talked with an editor about the work (at a meeting, for example), definitely mention this in your cover letter. This is less important if the team of editors is fairly small (but I think it's still worth doing) - at Nature, there's a fairly large editorial team and your paper may not be assigned to the person you talked with (this is especially true for multidisciplinary work). Though we circulate new submissions to editors who handle papers in related areas, it's always good to know if you've talked with someone else on the team, as this will ensure that they see the paper before any editorial decision is made.

6. Always suggest referees - most journals let you list a few potential referees that you feel are particularly qualified to review the work. But don't put down your old Ph.D./post-doc advisor or someone who you've recently published with (as many editors check PubMed or other databases before contacting referees) - even if there is no actual conflict of interest, many editors avoid a situation where there could be a perceived conflict of interest. These lists tend to be useful starting places when contacting referees (especially if there is a special technique involved or if the paper involves a discovery in a relatively small field).

7. Nature allows authors to submit a short list (usually two or three names) of people working on related work (or people who the authors feel may not be able to act as an impartial referee). This is very useful information, as (unfortunately) competition and bias exist, and it's best to know this before we start contacting referees. But please keep the list short - I've seen entire departments or schools listed in this section - or you may get an email from the editor asking you to revise your list.

Hmm - I think that's it. I guess I'm a few shy of 50 - any other NPG editors want to add their thoughts?

Joshua


Joshua Finkelstein (Senior Editor, Nature)

April 11, 2007

Very superstitious...


I was chatting with a pregnant co-worker yesterday about how many old wives' tales there are about 'predicting' the sex of a pregnant woman's fetus. For example, she mentioned that there's an old wives' tale in Greece that says that if you have a turtle in the house, and the turtle grows faster from neck-to-tail than from side-to-side, it's a girl. Otherwise, it's a boy. (Or maybe it's the other way around?)

I was thinking about this last night and realized that - though I'm generally quite skeptical and I don't believe in old wives' tales - I was fairly superstitious back in graduate school. I'm the proud owner of a 'lucky' calculator that came to almost every exam I've taken since 9th grade. And there were certain t-shirts I wore to lab on 'important' days (maybe when running a reaction for the first time or when I was performing a key biochemical/cellular assay...) I wasn't alone in this regard: other people in the lab had 'lucky' pens or certain rituals they performed before doing an important experiment...

How about you? Any superstitions or rituals that you do (or did) in the lab that don't make any scientific sense? Do you ever have trouble reconciling your scientific/logical side with the superstitious side?

Joshua


Joshua Finkelstein (Senior Editor, Nature)

March 26, 2007

ACS: The wheels on the bus (don't move at all...)


Though Lake Michigan is quite beautiful, it's pretty tough to appreciate the view when you're in the back of a stalled bus in the middle of Lakeshore Drive. Luckily, it only took 15 minutes for a replacement bus to arrive...

Despite this minor setback, I made it to the conference center in time to see most of the symposium in honor of Dave Evans. Evans talked about a few recent total syntheses from his group, including Oasomycin A, which was recently completed (see also these two papers). He's a great speaker who really holds your attention for the whole talk: he only discusses the most interesting reactions/transformations (and not every single step of the synthesis) and he uses some color (but not too much) to draw your attention to key atoms and/or newly formed bonds.

Later on in the afternoon, I made my way over to see Regan Thomson's talk on his recent synthesis of (+)-symbioimine. I really enjoyed his talk - I've known Regan for years and it's always exciting to see people you know publish interesting work... But the chair of the session really didn't bring her 'A' game today - she had trouble pronouncing his name (calling him 'Dr. Thomas' twice), fumbled through the word 'osteoclastogenesis,' and completely mis-pronounced the name of the molecule. OK - I agree that 'osteoclastogenesis' isn't a very common word, but I think it's pretty important to get the names of the people in your session correct. (Maybe I'm just overly sensitive about names, as so many people have trouble pronouncing mine...)

Well I'm bushed and it's not even 10 PM - it's amazing how exhausted you can get by running around from session to session... For those of you who are here in Chicago, how's your meeting going? What session/talk/event has been the most enjoyable for you? What are you looking forward to seeing tomorrow?

Joshua


Joshua Finkelstein (Senior Editor, Nature)

March 25, 2007

ACS: My kind of town


I made it in to Chicago late last night (only two hours late, which for isn't that bad for O'Hare...) There must have been a few chemists on my flight, as I wasn't the only person who chuckled when they announced that our pilot's name was Dave Evans...

I got up early this morning to check email, plan my day at the conference, and make a few last minute adjustments to an iPod playlist (it's a 20-25 minute bus ride from my hotel to the convention center). When traveling for work, I usually create a playlist to 'match' the location of the conference: Radiohead works well if you're heading off to an RSC conference, but a meeting in Chicago really calls for some Robert Johnson and Muddy Waters... (This isn't always easy - I'm not sure what I'm going to do for the 2009 ACS meeting in Salt Lake City. Any suggestions?)


Anyways, this morning I saw a great talk from Dennis Dougherty - most of the talk focused on cation-pi interactions in ligand-gated ion channels (for example, the Cys-loop superfamily) and how his laboratory has used unnatural amino acid mutagenesis to dissect how nicotinic acetylcholine receptors work (click here for his Nature paper from 2005 - I think it's a great demonstration of how organic/physical organic chemistry can be used to reveal how a biological system works...)

After grabbing a quick (and remarkably expensive) bite to eat, I went to Linda Hsieh-Wilson's and Jotham Coe's talks, both of which were great. Coe talked about Varenicline/Chantix, which looks like it'll really be able to help people who want to quit smoking.


If you're blogging from the conference, please let us know/please feel free to mention it in the comments section - so far, I know that

Richard from Chemistry World
Egon from chem-bla-ics
Kyle from The Chem Blog

are here (I'm not sure if all of them are blogging, though...) As Katharine mentioned, her news@nature blog posts can be found here.

Joshua


Joshua Finkelstein (Senior Editor, Nature)

March 23, 2007

NPG at the 2007 Spring ACS meeting


As you probably guessed, several editors will be attending the spring ACS meeting next week - you might remember that we created special conference websites for the spring and fall ACS meetings last year. This year there's been a major overhaul to our Chemistry Portal - in addition to the list of recent content from Nature, Nature Biotechnology, Nature Chemical Biology, Nature Materials, Nature Methods, Nature Nanotechnology, Nature Protocols, Nature Reviews Drug Discovery, and news@nature.com, there's a new section entitled "Looking Back."

The "Looking Back" page contains a list of Nature chemistry papers that 'caught our eye' for one reason or another and were published between 1950 and 2000 - there are a few 'classic' Nature papers (for example, Watson & Crick's Molecular structure of nucleic acids: a structure for deoxyribose nucleic acid and Kroto et al.'s C60: Buckminsterfullerene) and a few you might recognize from courses you took in college or graduate school (for example, Jones et al.'s paper Stereochemistry of phosphoryl group transfer using a chiral [16O, 17O, 18O] stereochemical course of alkaline phosphatase and Nicolaou et al.'s Total synthesis of taxol). There's even a 1950 paper from RB Woodward (Structure of chlorodesoxypatulinic acid) and a 1969 paper from EJ Corey (Biological activity of synthetic prostaglandins)... Have a favorite? Think we missed a key paper? Please let us know...


As Katharine mentioned yesterday, we've also put together a special issue of Nature - the issue is packed full of chemistry, so if you're at the meeting, swing by the NPG booth and pick up a free copy...

There's a News & Views Q&A on C-H activation from Bob Bergman, a review article from David Gorin & Dean Toste on relativistic effects in homogeneous gold catalysis, a Careers and Recruitment piece in our Naturejobs section, and several primary research papers:

Total synthesis of marine natural products without using protecting groups by Phil Baran et al. (click here to read the N&V)
Biasing reaction pathways with mechanical force by Charles Hickenboth et al. (click here to read the N&V)
BluB cannibalizes flavin to form the lower ligand of vitamin B12 from Michiko Taga et al. (click here to read the N&V)

We'll be adding blog entries throughout the conference, so please check back frequently to see what we’re writing about...

See you at the meeting!

Joshua


Joshua Finkelstein (Senior Editor, Nature)

March 19, 2007

Making a list...


We’ve decided to create a chemistry eTOC (an "electronic Table of Contents") that will highlight recently published chemical & biochemical papers from Nature, Nature Chemical Biology, Nature Materials, Nature Reviews Drug Discovery, Nature Nanotechnology, Nature Biotechnology, Nature Methods, and Nature Protocols.

For now, the chemistry eTOC will include ‘back half’ content (primary research and review articles) from all eight journals and ‘front half’ content (editorials, news features, news & views, etc.) from Nature. (Our long-term goal is to include ‘front half’ content from the research journals as well…) In addition, the eTOC will contain recent blog posts from this blog, highlight several chemistry jobs from our NatureJobs website, let you know about other developments from NPG in chemistry, and will occasionally include content from other NPG titles (for example, the recent Nature Reviews Microbiology review entitled "Microfabrication meets microbiology" and the 2006 Nature Reviews Molecular Cell Biology review entitled "A chemical toolkit for proteins – an expanded genetic code").

We’re hoping that this eTOC will make it easier for chemists who only read one or two NPG journals find interesting papers/reviews/etc. that are published in other NPG journals (for example, ones that they rarely/never read from cover-to-cover).

The first eTOC will go out during next week's ACS meeting (on Monday, March 26th) and future eTOCs will be sent out twice a month - so please sign up today!

Joshua Finkelstein (Senior Editor, Nature)
Stuart Cantrill (Associate Editor, Nature Nanotechnology)

February 14, 2007

Time is on my side


I was just talking with Catherine, and we can't remember if "a week in the library will save you a day in the lab" or if "a week in the lab will save you a day in the library"? I guess if you're starting a new project, maybe it's best to set up a whole bunch of experiments to see what works (steering clear of the dogma you’d find in published papers). But if you're nearing the end of a total synthesis, you probably want to play it safe with your milligram/sub-milligram quantities of your natural product and spend a bit more time in the library trouble-shooting problems...

What about other quotable quotes? Was RB Woodward right ("A scientist has to work very hard to get to the point where he can be lucky.") or was Ralph Waldo Emerson right (“Shallow men believe in luck. Strong men believe in cause and effect.”)? (The Google fight results are closer than you'd think...) Is time on your side or does time pass more quickly as your Ph.D./post-doc progresses?

What do you think/what's your scientific philosophy? Does it match up with the prevailing philosophy of your lab? What other quotes (or song lyrics) come to mind when you think about the last six months of your scientific research?

Unfortunately, we aren't able to set up a poll on the blog, so we'll have to do it the old fashion way - please leave us a comment with your thoughts...

Joshua


Joshua Finkelstein (Senior Editor, Nature)

February 13, 2007

I've got the power


I must admit, I really enjoy riding the bus to work - it's not just because of the unusual people you tend to meet on public transportation (though that's half the fun), but because the rides are long enough for me to skim through various journals to see if there's anything I want to read later on in the day. Normally there are a few things that catch my eye, and I'll set them aside for a lunch break (or while I'm waiting for the bus at the end of the day). But my plan to quickly skim through this week's Science failed completely - it's jam-packed full of interesting articles, and I needed to set aside a few hours to read through them all.

It's a special issue focused on 'Sustainability and Energy,' two topics that are obviously important these days - it starts out with a few 'Profiles' of major players in the field (I especially enjoyed reading the ones on Dan Nocera, Jay Keasling, and James Dumesic) and then there's a number of 'Perspectives' (I'd recommend starting with the ones by Whitesides & Crabtree and Stephanopoulos).

Reading through this material made me feel like (somewhere along the way) I should have had a class or two that focused on the chemistry/biochemistry of energy research. Before I started working at Nature, I hadn't really been exposed to this topic in much detail, despite taking (what felt like) dozens of classes in my undergraduate days. Those classes tended to focus on 'pure' chemistry/shy away from applications, and the graduate classes I took were fairly specialized/on completely different topics...

One of my undergraduate physical chemistry classes had both chemists and civil engineers in it, and I remember that the questions asked by the civil engineers ("Is this why cement dries on the outside first?") generally annoyed the chemists - is this a clash of the two cultures (i.e., science vs. engineering), or were my experiences the exception and not the rule?

Do you think we are doing enough to make sure that future generations of chemists are prepared to tackle important problems in energy research? Sure - you could argue that applied chemistry is the domain of the chemical engineers and that chemists shouldn't learn this sort of stuff at the undergraduate level. But shouldn't we be doing more to expose undergraduate chemists to important topics involving applied chemical research (for example, by requiring chemistry majors to take a chemical engineering class or two)?

Joshua


Joshua Finkelstein (Senior Editor, Nature)

February 02, 2007

Day TRP-per


Looking for something to read while you're waiting for the rotovap to free up or the PAGE gel to finish running? You might want to take a look at yesterday's issue of Nature, which has a number of chemistry/chemical papers. In addition to the paper by Serreli et al. that Katharine and Stuart mentioned, there's a News & Views piece from Steven Nolan on Craig Forsyth's recent ACIE paper and a paper from Stern et al. that describes miniature, ultra-sensitive sensors that can detect unlabeled antibodies at concentrations below 100 femtomolar (and can monitor the cellular immune response in 'real-time').

There's also a cool paper involving the TRPA1 channel - TRP channels respond to "temperature, touch, pain, osmolarity, pheromones, taste, and other stimuli," and the TRPA1 channel specifically responds to a range of structurally-diverse compounds, including mustard oil, acrolein, and icilin.

In Macpherson et al., the authors used 'click chemistry' to show that derivatives of mustard oil and cinnamaldehyde covalently bound to the TRPA1 channel. They used mass spectrometry to identify fourteen TRPA1 cysteine residues that reacted with iodoacetamide, three of which were required for normal channel function. From a chemical standpoint, this might not seem all that surprising, but this is apparently the first ion channel known to be activated by this mechanism, and I think it's interesting to see how "tuning TRPA1 to respond to covalent modification by reactive compounds ... [enables the nervous system to] directly assess the noxious environment of sensory neurons." For those of you teaching biological/bio-organic chemistry courses, this might make a good test question - it's a nice 'real world' example of how understanding basic organic chemistry can be used to explore how an enzyme works...

Joshua


Joshua Finkelstein (Senior Editor, Nature)

January 31, 2007

(Your love is like) bad medicine


I saw an amazing BBC documentary a few years ago called "Bad Medicine" - the documentary focused on Dora Akunyili, the Director General of Nigeria's National Agency for Food and Drug Administration and Control (NAFDAC), and her efforts to eradicate fake pharmaceuticals/counterfeit drugs in Nigeria.

Before Akunyili took over her post in 2001, a staggering 80% of the medications sold there were deficient in one way or another. Some contained less of the active ingredient than was specified on the label. Others were past their expiration date. Some were filled with inert lactose or powdered chalk.

The stories she told were astonishing: after cracking down on the counterfeiters, they "fought back ... [burning] down Nafdac's offices and threaten[ing] to kill her and her children"; "snipers opened fire on her car ... [and] a bullet pierced through [her] head scarf and grazed [her] scalp"; when the International Children's Heart Foundation visited Nigeria to perform heart surgery on children, four died because someone had replaced the adrenaline with water. It was a heart-wrenching documentary about how far some people will go to make money, and how hard it is to stop them: the World Health Organization "estimates up to 25% of medicines consumed in developing nations are counterfeit or substandard" and this problem isn't restricted to countries in the developing world.

So I was excited to read a recent news@nature.com story by Katharine Sanderson about a paper that just came out on Analytical Chemistry's ASAP. The authors used spatially offset Raman spectroscopy (SORS) to examine ibuprofen and paracetamol (acetaminophen), without removing them from their blister packs/bottles - the hope is that existing handheld Raman spectrometers could be turned into portable SORS detectors and that these devices could be used by people like Dora Akunyili to quickly determine whether or not a drug is counterfeit...

Joshua


Joshua Finkelstein (Senior Editor, Nature)

January 26, 2007

DIY Drug Discovery


Hi everyone - sorry it's been such a long time since I've posted. December and January are pretty crazy months around here... (There's usually a huge spike in submissions at the end of each year and it often takes a few weeks to work our way through the long backlog... Now that things have quieted down a bit, I hope to post more regularly...)

Anyways, a comment from yesterday's In the Pipeline caught my eye:

You never seem to discuss the current absymal [sic] state of employment for chemists. What reality are you living in? Maybe you should stick to the 'chemistry is fun talk'? You do your field a disservice by constantly ignoring reality.

Now I certainly don't want to trivialize how difficult it can be to find a job in the pharma/biotech sector, but those of you who aren't happy with your current position/are looking for another job might want to read this 'Careers and Recruitment' piece that was recently published in Nature Reviews Drug Discovery. The article focuses on two "biopharma company founders" - Alice Huxley (President and Chief Executive Officer, Speedel) and Dominic Behan (Chief Scientific Officer and Senior Vice President, Arena Pharmaceuticals) - who "discuss their experiences and highlight factors that have been important for success."

Huxley was a global project manager working on renin inhibitors, and after the merger of Sandoz and Ciba–Geigy (to create Novartis) it looked like that project was in jeopardy - Huxley "believed strongly in the potential" of the lead renin inhibitor in the program and was able to convince the management to "let me take on the project within Speedel and prove that it would work." The outcome? That compound - Aliskiren - is now in Phase III clinical trials. Behan founded Arena Pharmaceuticals with two colleagues in 1997 and has helped it grow to 300 employees. They now have a drug candidate - Lorcaserin - in Phase III trials for obesity and several other compounds in clinical and preclinical development.

So let's say you have a great idea and want to start your own company - what's the next step? How do you turn those late-night conversations at the pub with your coworkers into a real company? (And I don't mean a garden in your backyard that you call a 'massive pharmaceutical factory.') Though I know a few people who have started their own biotech companies (and though there's lots of information about venture capital companies on the web), I don't have any personal experience in this area... Maybe some of our readers have been through this process and know what to do next/who to approach with your ideas?

Joshua


Joshua Finkelstein (Senior Editor, Nature)

December 07, 2006

Click click bang bang


Banert et al. recently published the first synthesis of tetraazidomethane (and some of its "exciting chemistry"). Like it's cousin triazidomethane, this compound is highly reactive/explosive:

Safety Precautions: Tetraazidomethane (1) is extremely dangerous as a pure substance. It can explode at any time - without a recognizable cause. Less than a drop ... is able to destroy completely not only the glass trap but also the vacuum Dewar flask of the cooling bath.

It looks like it's a lot easier to make than octanitrocubane, so we'll just have to hope that there aren't any terrorists out there who subscribe to ACIE... (As an aside, I don't think there are any official policies for papers that contain explosive chemical reagents, but when it comes to biological papers that contain information that could be exploited by terrorists, many journals "have a policy in which editors will screen and, if necessary, reject manuscripts submitted for publication if 'an editor ... conclude(s) that the potential harm of publication outweighs the potential societal benefits.'")

Though this study sounds somewhat esoteric at first, when tetraazidomethane was reacted with norbornene, the authors isolated two unexpected 5-aminotetrazole derivatives (see Scheme 2). The authors haven't done a detailed mechanistic analysis yet, so a bit more work is needed to learn exactly what's going on - in the meantime, I think this would be a great question to test your students' (or friends') arrow-pushing skills...

Joshua


Joshua Finkelstein (Senior Editor, Nature)

December 01, 2006

Next week's Novartis symposium...


If you live in the Boston area and you're an organic chemist, you've probably heard about the upcoming Novartis Symposium on Advances in Organic Synthesis to honor Professor Dave Evans. (Thanks to Paul Bracher for this info.) It's on Tuesday (December 5th) at MIT's Kresge Auditorium and there's an excellent lineup of speakers. I think you can still sign up (and it's free...)

Kresge Auditorium is a stone's throw away from the Miracle of Science Bar & Grill, so if I don't bump into you during one of the breaks, keep an eye out for me at the end of the day - maybe we can grab a post-symposium pint...

Hope to see you there,

Joshua


Joshua Finkelstein (Senior Editor, Nature)

November 30, 2006

Feedback loop


For those of you who celebrated Thanksgiving, I hope you had a relaxing holiday and an enjoyable Thanksgiving dinner (raise your hand if someone tried to convince you that the tryptophan in turkey makes you tired...) My wife and I had a small gathering at our apartment, where we consumed the Roast Ox potato chips and I learned that Lay's makes turkey-flavored potato chips ("They really do taste like turkey with gravy ... It's like combining the best parts of Thanksgiving dinner, all in one bag.")

Anyways, when I was in London a few weeks ago, I had my yearly appraisal - these appraisals always take place in November or December, so we often talk about our plans for the following year... We already have a few things planned for 2007 (and 2008), but I'd be curious to hear what you'd like to see more of (or less of) next year. I'm not just referring to primary research; we try to make sure chemistry appears throughout the journal - for example, in editorials, News Features, News & Views articles (on papers published in Nature and in other journals), Insights and review articles, essays, etc.

We often get feedback from the community when we're at meetings (positive and negative feedback - both can be quite helpful), but since there aren't many chemistry meetings coming up in the next few months, I thought this might be an easy way to find out what you think (anonymously if you'd prefer...)

Thanks in advance for your comments!

Joshua


Joshua Finkelstein (Senior Editor, Nature)

November 17, 2006

If you don't eat yer meat, you can't have any pudding...


As Stuart mentioned in his last post, I’ve been in the London office all week. I always have a great time when I’m in London (where else can you see Patrick Swayze in ‘Guys and Dolls’?) and wish I could travel here more frequently…

There’s a large selection of flavored potato chips/crisps here – my sister is a vegetarian, so I always try to bring her back the meatiest or fishiest flavor I can find (I’ve given her ‘Roast Minted Lamb’ and ‘Prawn Cocktail’ in the past). But this time I think I’ve outdone myself: I noticed a bag of ‘Roast Ox’ flavored crisps in the building's vending machine…

A few minutes and 50 pence later, I went over to Stuart’s desk to show him my prize - but a closer look at the packaging revealed that the crisps were vegetarian-friendly. How could this happen? What vegetable products could be used to re-create the complex flavors (or flavours) that one would normally associate with a roasted ox?

Stuart and I scanned the ingredients for more information:

Potatoes, Sunflower Oil, Roast Ox Flavour (Salt, Hydrolysed Soya Protein, Sugar, Lactose (from milk), Yeast Extract Powder, Wheat Flour, Flavour Enhancer: Monosodium Glutamate, Dried Yeast Powder, Onion Powder, Flavourings, Acidity Regulator: Sodium Diacetate, Spice Extracts, Anti-caking Agents: Silicon Dioxide & Calcium Phosphates, Herb Extracts, Garlic Powder, Colour: Paprika Extract)

So which chemical (or combination of chemicals) tastes/taste like ox? Are there any food and flavor chemists out there who can tell us more?

Joshua


Joshua Finkelstein (Senior Editor, Nature)

October 17, 2006

Talk talk


A few of my colleagues are at the 2006 Society for Neuroscience meeting this week, and I think it's really interesting that the SfN invited architect Frank Gehry to speak at their meeting (in the "Dialogues between Neuroscience and Society" lecture/section). This isn't the first time they've invited a famous non-scientist to speak at the annual meeting - the Dalai Lama of Tibet spoke last year - and it's not entirely clear if the lecture was a success: one neuro-blogger wrote that she "throuroughly [sic] enjoyed seeing the pictures of his work ... [though he did not] attempt to draw his narrative into the realm of neuroscience."

This got me thinking - who could a large chemical society (like the ACS) invite to speak in a "Dialogues between Chemistry and Society" seminar? The late R. Buckminster Fuller would have been an obvious choice for chemists interested in nanotechnology, and the late Rachel Carson could have spoken in front of the Environmental Chemistry division... As for living non-scientists, maybe Tracy Kidder could speak in the Computers in Chemistry division?

If you were in charge of a "Dialogues between Chemistry and Society" seminar, who would you invite and why?

Joshua


Joshua Finkelstein (Associate Editor, Nature)

September 25, 2006

Better late than never...


I just wanted to write a quick post to let you all know that we've (finally) added a blogroll - it's under 'Related Links' on the left-hand side of the webpage:

Chemistry World Blog
Everyday Scientist
Interfacial Science
In The Pipeline
Molecule Of The Day
Post Doc Ergo Propter Doc
Peter Murray-Rust's Blog
She Blinded Me with Science
Tenderbutton (though Dylan's going to 'turn off the lights' on October 1st)
Totally Synthetic
The Chem Blog
The Endless Frontier
Whistling in the Wind

This is certainly not a complete list of blogs about chemistry/by chemists, so please let us know if there are any excited/interesting chemistry blogs we've missed...

Joshua


Joshua Finkelstein (Associate Editor, Nature)

September 20, 2006

Grand theft auto: Levinthal paradox city


I doubt many people think about protein folding when shopping for a new video game console, but if you're interested in protein folding and thinking about buying a PlayStation 3 next month, there's an article on CNN.com you should read. Apparently "Sony worked with Stanford University's Folding@home project to harness the PS3's technology to help study how proteins are formed in the human body and how they sometimes form incorrectly."

Folding@home is a distributed computing project, which means you can download a program onto your computer (in this case, your new PS3) that will enable you to donate 'down time' to analyze chunks of data. By dividing the "calculations into smaller packets ... [the computers can] do jobs that would strain the most powerful supercomputers." And since the PS3 has a pretty powerful graphics card, you can apparently "watch the protein as it folds."

Folding@home isn't the only distributed computing project out there: you've probably heard of SETI@home and there are a number of other projects, including Rosetta@home, the Drug Design and Optimization Lab, and fightAIDS@home.

I think this is a great idea: Sony hopes to sell 2 million PS3s in the United States and Japan in 2006 and 6 million worldwide by March, so using gaming consoles in @home projects could dramatically decrease the time needed to do these computations...

Joshua


Joshua Finkelstein (Associate Editor, Nature)

September 13, 2006

ACS: Sittin' on the dock of the bay


After the morning session, I jumped in a cab and went to UCSF's Mission Bay campus - it's a 43-acre campus that was acquired at no cost to the university and contains a number of laboratories, centers, and research institutes. It's quite large and is getting bigger: "[a]bout 1,700 faculty, students, scholars and staff already work in the new UCSF Mission Bay campus community. At full build-out, 9,100 people are expected to work and study at the new campus."

I had a meeting with a professor in Genentech Hall, a 434,000 square foot building where many of the chemical biologists work (there are also a number of structural, molecular, and developmental biologists in the building).

It truly is a beautiful building, and the entire campus looks like it'd be a great place to work - none of the grey/dirty walls and strange odors found in older chemistry/biochemistry bulidings... I'd highly recommend checking out the campus next time you're in San Francisco - but security is pretty tight, so you might want to sign up for the tour. In the meantime, click here for the virtual tour...

Joshua


Joshua Finkelstein (Associate Editor, Nature)

September 12, 2006

ACS: All that glitters is gold


The morning session of the Arthur C. Cope Award and Arthur C. Cope Scholar Awards just finished - I was really impressed with F. Dean Toste's talk, which was a whirlwind tour of some of the work his group has done involving gold(I)-catalyzed reactions.

There are now a number of groups exploring the chemistry of gold(I) and gold(III) complexes - Toste's group has focused on gold(I) complexes, which are air-/moisture-tolerant and able to catalyze a number of reactions, including the stereoselective cyclopropanation of olefins and intramolecular acetylenic Schmidt reactions (making substituted pyrroles). They've also shown that these reactions can be used to make natural products, recently demonstrating that the gold(I)-catalyzed cyclization of a silyl enol ether onto an alkyne enabled them to rapidly synthesize (+)-lycopladine A (in eight steps with 17% overall yield from the starting enone).

Joshua


Joshua Finkelstein (Associate Editor, Nature)

ACS: I love technology


David Schwartz gave a great talk this afternoon - he's the director of the National Institute of Environmental Health Sciences, which recently created the 'Genes and Environment Initiative,' a five-year research effort that hopes to identify the genetic and environmental causes of asthma, arthritis, and other common diseases.

The initiative has two components: the first involves "efficiently analyzing genetic variation in groups of patients with specific illnesses," and the second involves the development of new devices that can monitor "personal environmental exposures that interact with genetic variations and result in human diseases."

Why - you might ask - is the NIH spending approximately 192 million dollars on this new initiative? Well, we know that "[g]enetic and environmental factors, including diet and life-style, both contribute to cardiovascular disease, cancers, and other major causes of mortality," and there's a growing body of evidence that suggests that environmental factors are responsible for a large percentage of these diseases.

The NIEHS will use a portion of this money to fund grants that involve "innovative new technologies to measure environmental toxins, dietary intake and physical activity, and to determine an individual's biological response to those influences, using new tools of genomics, proteomics and metabolomics," so this looks like an excellent opportunity for chemists interested in complex diseases and human health.

For more information on the NIEHS 2006–2011 Strategic Plan, see "New Frontiers in Environmental Sciences and Human Health."

Joshua


Joshua Finkelstein (Associate Editor, Nature)

September 11, 2006

ACS: Nobel laureate book club


I only have time for a quick post before I run off to David Schwartz's talk on 'Environmental genomics and human health.' I just left the H.C. Brown Legacy Symposium, where Professor Sharpless talked about 'click' chemistry, azido-phobia, pandas, and Kevin Kelly's Out of Control (which he highly recommended). Needless to say, it was a great talk and I learned a few new things about 'click' chemistry: it turns out that the Huisgen 1,3-dipolar cycloaddition works pretty well in Jack Daniel's whiskey and in human plasma...

I also bumped into Mark Peplow, who used to work at Nature and is now the editor of Chemistry World. He's blogging about the conference, and he's not alone: the ACS, Tenderblog, the Chem Blog, and Chemical Forums are here too... Update: C&EN and Peter Murray-Rust are also blogging from the conference.

Joshua


Joshua Finkelstein (Associate Editor, Nature)

September 08, 2006

It's not easy being green


In yesterday's issue of Nature, we published a paper from Amir Hoveyda's and Mark Snapper's groups at Boston College. The paper describes a simple metal-free catalyst that can perform enantioselective catalytic silylations on a variety of meso 1,2-diols, obtaining mono-protected chiral diols.

In the accompanying News & Views article, Scott Denmark wrote

The chemical yields and enantiomeric selectivities of the reactions are very good - in some cases, excellent - although the reaction times are long (2-3 days). Relatively large amounts of the catalyst are required, but this is not a problem as the catalyst is simple to prepare from inexpensive starting materials. Clearly this is just the beginning of a development process and more active catalysts will be forthcoming.

These kinds of catalysts could shave several steps off synthetic routes to prostaglandin analogues, unnatural nucleosides, and neocarzinostatin analogues, which currently require a number of chemical transformations and an enzymatic de-acylation to obtain a key building block. By shortening the synthetic route, the amount of chemical waste produced can be minimized and the amount of time needed to make the molecule can be dramatically reduced. Denmark concludes the News & Views article by saying that

this procedure is likely to have a significant impact on the efficiency and cost of constructing single-enantiomer products. Most importantly, however, this report demonstrates the creative power of synthetic chemistry to build simple organic catalysts that mimic and ultimately surpass, biological catalysts - especially for non-biological transformations.

Collaborations between two well-known organic chemistry labs aren't extremely common, and Hoveyda talked about this phenomenon on our 'Authors' page:

Hoveyda says the synthetic organic chemistry field has traditionally been wary of two principal investigators sharing credit on single papers. "The culture almost discourages it," he says. Early on, colleagues warned Snapper that working with a more senior researcher could hurt his career. But their partnership has been fruitful; the two have received joint grants from the National Institutes of Health since 1997 and have published about 20 papers together. "The reason this collaboration has been so successful is that neither of us cares who gets the credit," Hoveyda adds.

If you’d like to learn more about the research, Hoveyda was interviewed on this week’s Nature Podcast (he also appears on the recent chemistry podcast). And if you're in San Francisco at the Fall ACS Meeting next week, you can see Yu Zhao talk about the work on Monday afternoon.

Joshua


Joshua Finkelstein (Associate Editor, Nature)

NPG at the 2006 Fall ACS meeting


As I mentioned yesterday, I'll be attending the ACS meeting next week... You might remember that we created a special conference website for the Spring ACS meeting - well, we've updated the conference website for this ACS meeting:

- once again, there is a list of some of the sessions the editors will be attending.

- there is a special edition of the Nature Podcast, in which Dr. Simon Frantz talks with the authors of several recent chemistry papers from Nature, Nature Reviews Drug Discovery, Nature Chemical Biology, Nature Materials, and Nature Methods. The five papers featured on this podcast are:

Enantioselective silyl protection of alcohols catalysed by an amino-acid-based small molecule by Zhao et al. (Nature)
Targeting proteases: successes, failures and future prospects by Turk (Nature Reviews Drug Discovery)
Small-molecule activation of procaspase-3 to caspase-3 as a personalized anticancer strategy by Putt et al. (Nature Chemical Biology)
Molecular computational elements encode large populations of small objects by de Silva et al. (Nature Materials)
An unnatural hydrophobic base pair system: site-specific incorporation of nucleotide analogs into DNA and RNA by Hirao et al. (Nature Methods)


We've also added a few recently published papers to the list of exciting chemistry papers from Nature, Nature Chemical Biology, Nature Materials, and Nature Methods - some of these papers can be downloaded for free during the ACS meeting. We hope you enjoy reading these papers as much as we did, and would love to hear what you think about them...

And finally, I'd like to mention that this happens to be our 100th blog entry - on behalf of all of us, I'd like to thank you for coming back here week after week...

We'll be adding blog entries throughout the conference, so please check back frequently to see what we’re writing about...

See you at the meeting!

Joshua


Joshua Finkelstein (Associate Editor, Nature)

September 07, 2006

Sympathy for the chemist


For some reason, many non-scientists (and even some scientists) see chemists as "nefarious creators of toxic pollutants ... [or] mad scientists brewing up Love Potion #9 in ... [a] cluttered and archaic laboratory." Or worse yet, they think chemistry is boring and/or useless...

The editorial in the September 7th issue of Nature tries to capture why organic chemistry is interesting and attempts to explain some of the things that excite the 'average' organic chemist. (Though the editorial is mainly about organic chemistry, I think many of the statements in the editorial are true for other areas of chemistry...)

Many organic chemists spend their days searching for creative solutions to real-world problems, yet the media pays them just a fraction of the attention devoted to physicists or biologists. Even fellow scientists think organic chemistry is esoteric ... [But a]sk a group of organic chemists why they love their work ... and most will tell you that it enables them to make things that no one else has made before ... [C]hemists are frequently drawn to the field because there is not just one way to solve the problem, and the search can reveal a bit more about how the world works.

When people ask me why I like being an editor, I often tell them that it's like being a first year graduate student again: every day I get to read exciting chemistry papers and often feel like that "child in a sweetshop" - there are so many interesting discoveries out there, and countless problems that still need to be solved. The excitement peaks when I'm at a meeting - I love going to sessions and hearing people talk about their unpublished/newly published work, meeting students and post-docs at the poster sessions, and chatting with speakers after the talks about their future plans...

With that in mind, I hope to bump into you at the ACS meeting next week - keep an eye out for Catherine Goodman (from Nature Chemical Biology), Mirella Bucci (from Nature Chemical Biology), and Emma Marris (from the Nature news team) who are also in town for the meeting. And don't forget to check back here regularly, as we'll be blogging throughout the meeting...

Hope to see you there,

Joshua


Joshua Finkelstein (Associate Editor, Nature)

September 05, 2006

I still haven't found what I'm looking for


In this month's issue of Nature Reviews Drug Discovery, Monya Baker wrote a 'News & Analysis' piece about open access chemistry databases: though there are a number of free chemical databases (including PubChem, which I blogged about last spring), "the chemical data [in these open access databases] still pale in comparison to what already exists in other databases and the published literature."

One problem is that it takes a great deal of time to collect data for these large databases: "PubChem's director, Stephen Bryant, says he lacks the staff and mandate to collect data from published literature and patents." So it's not surprising that the Chemical Abstracts Service (CAS) database contains more chemical information than PubChem: whereas PubChem has about eight million unique structures, CAS contains nearly 30 million organic and inorganic substances.

In addition, there are some concerns about quality control in these open access databases: "[t]he screening data [in PubChem] are less rigorous than those in peer-reviewed articles, and contain many false positives. Deposited data aren't curated, and so mistakes in structures, units and other characteristics can and do occur." I can't imagine how frustrating it would be to synthesize a molecule that was listed as a 'hit' in one of those databases just to find out that it was inactive because someone mixed up the stereochemistry (or omitted a double bond)...

What are your experiences with these databases? Have you used them in your own work? If so, were they useful? What would you do to make them better? Do you think that the problems with these open access databases are the sort of 'growing pains' that happen for any new technology/database, or is there something special/unique about developing open access chemistry databases?

Joshua


Joshua Finkelstein (Associate Editor, Nature)

August 30, 2006

2 + 2 = 5


In the August 31st issue of Nature, there’s a short ‘picture story’ I wrote about a recent Cell paper from Lee et al. Those authors found that in Trypanosoma brucei (the parasite that causes African trypanosomiasis) the fatty acid myristate is not made by type I or type II fatty acid synthases, but is instead made by a series of enzymes called elongases. These enzymes extend the fatty acid chain, adding two carbon atoms at a time to a fatty acid that is attached to coenzyme A. Though more work is needed to explore how these enzymes function in vivo, the authors believe it may be possible to develop new anti-parasitic drugs that target these elongases.

According to the WHO/TDR, African trypanosomiasis (also known as 'sleeping sickness') affects 36 countries in sub-Saharan Africa and kills about 50,000 people each year. The TDR website says that "[t]reatment has always been difficult, especially when the disease has reached an advanced stage with central nervous system involvement, as few effective drugs are available." So hopefully small-molecule inhibitors of these enzymes could be used to reduce the morbidity and mortality associated with this disease.

If you're interested in reading more about their discovery, please go check out the picture story and the Cell paper.

Joshua


Joshua Finkelstein (Associate Editor, Nature)

August 29, 2006

Turn on, tune in, kill cells


If you read ScientificAmerican.com or the BBC News website this week, you may have heard about Putt et al., which was recently published in Nature Chemical Biology.

Procaspase-3 is an inactive form of caspase-3 (a cysteine protease involved in apoptosis) and the "conversion of procaspase-3 to caspase-3 results in the generation of the active 'executioner' caspase that subsequently catalyzes the hydrolysis of many protein substrates." Putt et al. screened a library of 20,500 compounds and identified a small-molecule - named PAC-1 - that activated procaspase-3 in vitro. They then showed that the small-molecule could induce apoptosis in a variety of cancer cell lines. Since PAC-1 was orally active in live mice and was able to retard tumor growth in three cancer models, the authors believe that this molecule (or its derivatives) could be used to treat cancer in humans one day.

If you want to learn more about the work and you’re attending the fall ACS meeting, Karson Putt will be talking about the work on Tuesday, September 12th in the Medicinal Chemistry Award Symposium. Paul Hergenrother will also be talking in that session (and receiving the award), though he will focus on new small-molecules that might be able to combat Parkinson's Disease.

Joshua


Joshua Finkelstein (Associate Editor, Nature)

August 28, 2006

A bottle of red, a bottle of white


If you're an oenophile and you're looking for a job in the near future, you might want to read Corinne Marasco's piece in today's Chemical & Engineering News. As long as you have "strong analytical skills, a good understanding of organic chemistry, and an interest in wine," there might be a job for you in the wine industry.

Lund & Bohlmann wrote a perspective in Science earlier this year, in which they argued that the "art [of making wine] is increasingly guided by science for many wine producers, and this trend will continue with a growing contribution from molecular-based technologies and knowledge." So it might be a good time to (go back to school and) get a graduate degree in Viticulture and Enology.

If you're attending the fall ACS meeting and you want to learn more about the field, you might want to swing by the "Chemistry of Wine" session. Hopefully the speakers will bring along a few bottles for the audience to taste-test...

Joshua


Joshua Finkelstein (Associate Editor, Nature)

August 23, 2006

Come together


In the September issue of Nature Chemical Biology, John Silvius wrote about McGill University's interdepartmental graduate program in chemical biology, which was established in 2002 and now has "roughly 30 graduate students, 10 postdoctoral fellows and 30 faculty mentors."

The program involves scientists from the Department of Biochemistry, the Department of Chemistry, and the Department of Pharmacology and Therapeutics, and a "key objective of the program is to maximize opportunities for students with chemistry and life science backgrounds to share and appreciate their sometimes distinct perspectives on the field of chemical biology." Silvius wrote that this is accomplished via seminar discussion meetings, workshops, and an "annual research symposium at which students present their work to other students and faculty mentors."

There are other interdepartmental and multi-institutional graduate programs in chemical biology: for example, there is the Cornell/Rockefeller/Sloan-Kettering Tri-Institutional Training Program in Chemical Biology in New York City (which involves Cornell University, The Rockefeller University, Memorial Sloan-Kettering Cancer Center, and the Weill Medical College of Cornell). Graduate students in the Tri-Institutional Training Program can rotate in (and join) laboratories at any of the institutions and they do not have to teach classes, "enabling them to take an accelerated course schedule (four courses per semester during the first year)." (Although I understand that the program was designed so the students could take a large number of classes, I really enjoyed teaching during graduate school and think it's an important experience for all graduate students. But I'll save that topic for another blog post...)

There's obviously more than one way to train the next generation of chemical biologists, but Silvius believes that

An effective training program in chemical biology must produce graduates who have a distinct sense of intellectual identity yet can work effectively with researchers that are more conventionally trained either in chemistry or in the life sciences alone... Moreover, by promoting constant intermixing of individuals trained in the cultures of chemistry and biology, such a program allows students to be participants in the very type of stimulating, creative ferment that drives the field of chemical biology itself.

If you are a graduate student in (or a recent graduate of) an interdepartmental or multi-institutional graduate program in chemical biology, I'd be interested in hearing your thoughts about your program/your experiences. Why did you choose an interdepartmental or multi-institutional graduate program, instead of a Department of Chemistry & Chemical Biology? (And for those of you who did their graduate work in a Department of Chemistry & Chemical Biology, why didn't you choose an interdepartmental or multi-institutional graduate program?) For those of you working on the interface of other disciplines (for example, biophysics, chemical physics, bionanotechnology, etc.) did your graduate program meet your (scientific) needs/expectations? If not, what could they have done to make it easier for you to pursue interdisciplinary research?

Joshua


Joshua Finkelstein (Associate Editor, Nature)

August 17, 2006

Endosymbiotic by nature


You might remember endosymbiotic theory from your high school or college biology classes: it's the idea that some organelles (for example, mitochondria and chloroplasts) were originally separate prokaryotic organisms that were engulfed by eukaryotic cells. Although it's not clear how or why this occurred, this became a mutually beneficial relationship for both cells (i.e., a symbiotic relationship), resulting in the organelle-containing cells that appear in biology textbooks (and in our bodies...)

But why - you might ask - would a chemist care about endosymbionts (organisms that live inside other organisms)? Well I think they're interesting because "[b]acterial symbionts have long been suspected to be the true producers of many drug candidates" isolated from natural sources. For example, there is some evidence that the antitumor polyketides of the pederin family are produced by an uncultured bacterial symbiont of Paederus beetles, which can cause dermatitis.

Late last year, Partida-Martinez & Hertweck discovered that another natural product (rhizoxin) is not biosynthesized by the fungus Rhizopus microsporus itself, but by a bacteria that lives inside the fungus. In a follow-up paper in JACS, these authors were able to isolate a rhizoxin-producing bacterial strain from the fungus ("Burkholderia rhizoxina") and could grow it in liquid culture. They lysed the cells, and found (quite surprisingly) that "about 40% of the crude extract is composed of rhizoxin derivatives" - in addition to rhizoxin, Burkholderia rhizoxina produces a number of related structures.

The authors determined that some of these natural products were 1,000 to 10,000 times more active than rhizoxin in cell-based assays (the assay was looking at antiproliferative activity). Rhizoxin went through extensive clinical trials in the 1990s and showed some promise as an anti-cancer drug, though it was not taken into Phase III clinical trials because it was not active enough in vivo. These authors hope that, since the derivatives they isolated are more active in vitro, they might more successful in the clinic. And since the natural products can be harvested from bacterial cultures, it may be possible to rapidly produce a large amount of these complex natural products without having to resort to chemical synthesis.

Joshua


Joshua Finkelstein (Associate Editor, Nature)

August 11, 2006

Almost Famous


As a follow-up to yesterday's post, I took a look at Wikipedia's 'List of Chemists': all the Nobel laureates have entries (for example, EJ Corey, Barry Sharpless, Ahmed Zewail, etc.) and though the top of the page boldly claims 'This is a list of famous chemists: (alphabetcal [sic] order),' this is by no means a fleshed out list of 'important' chemists: Margaret Thatcher is on the list, but George Whitesides didn't make the cut for some reason. (I don't mean any disrespect to the former Prime Minister, but I don't think many scientists think 'oh yeah, she's a chemist' when they hear her name...)

Whether you like it or not, Wikipedia has become the first place many people look to find information (online). But the information on chemists isn't up to snuff: as I mentioned, George Whitesides has an entry, but a number of other respected chemists in the same chemistry department don't appear in Wikipedia (for example, Eric Jacobsen, Andrew Myers, Eugene Shakhnovich, and David Liu, just to name a few...)

So I had a thought - let's flesh these Wikipedia entries out...

If you have time in the next week, add an entry for your Ph.D./post-doc supervisor, one of your co-workers (if you're a professor), or someone whose work you've enjoyed reading for years. If they already have an entry, add some (truthful) information to it... And if you add their names to the 'List of Chemists,' don't forget to put them in 'alphabetcal' order...

Joshua


Joshua Finkelstein (Associate Editor, Nature)

August 10, 2006

Fame (I'm gonna live forever...)


A few nights ago I was talking with my wife about fame (i.e., what makes someone a 'superstar') - it's pretty easy to understand why so many actors/actresses, musicians, and writers are household names (whether or not you like Ben Affleck or Shakira, many people know who they are...) The average person might not be able to name a living artist or dancer, though I bet a number of people would say "Christo and Jeanne-Claude" and "Baryshnikov"...

But if you asked the average person to name a famous living chemist, I wonder if they could name anyone... (This is probably not true in Japan, since Nobel laureates have a unique "celebrity status," but in most other countries I wonder what the average person would say...)

So the million dollar question is can anything be done about this? (A related question is should anything be done about this, but for the sake of argument, I'm going to assume that something should be done about this...) Movies are certainly the easiest way to inform the general public: Awakenings, A Beautiful Mind, and Kinsey helped popularize the names "Oliver Sacks," "John Nash," and "Alfred Kinsey."

So do we need a movie about Barry Sharpless? Or, as someone suggested on "In the Pipeline," should The Billion Dollar Molecule be made into a movie? I don't know about you, but I'd watch a movie about RB Woodward - from all the stories I've heard, he sounded like an interesting guy...

Joshua


Joshua Finkelstein (Associate Editor, Nature)

August 03, 2006

The big picture


The 'front half' of this week's Nature is packed full of chemistry - there's a News & Views by Tom Muir on a recent JACS paper from David Liu's group, Emma Marris wrote a short News piece on the controversy surrounding two recent syntheses of hexacyclinol, and Phil Ball wrote a News Feature on the big questions facing chemistry (or in his own words: "are there still major chemical questions to crack?")

In 2005, Science published a special issue that featured 125 'big questions' that scientists hope to solve in the next 25 years - some of the chemical questions included 'How far can we push chemical self-assembly?,' 'What is the structure of water?,' and 'Are there limits to rational chemical synthesis?'. Phil adds a few more questions to the list, including 'How do we design molecules with specific functions and dynamics?' and 'What is the chemical basis of thought and memory?'.

Let's say you had a lab of 20 highly competent graduate students and post-docs and was just awarded a large grant (how about one million dollars per year for five years - wouldn't that be nice...) What problem(s) would you work on? Would you tackle a basic/fundamental problem or use chemistry to explore an interesting biological system, make new materials/devices, develop new therapeutic agents, or something other application?

Joshua


Joshua Finkelstein (Associate Editor, Nature)

July 28, 2006

The incredible shrinking lab


The collection, preparation, and analysis of chemical compounds using miniaturized devices are appealing for many reasons: the use of smaller reagent volumes can reduce the time needed to synthesize and analyze a product, the amount of chemical waste produced and the overall costs can be reduced by performing chemical reactions in these 'lab-on-a-chip' devices, and compact devices also allow samples to be analyzed at the point of need rather than at a centralized laboratory. For these reasons, chemists are now using these devices to create new molecules and materials, and biologists are employing these devices to study complex biological problems. Furthermore, labs on chips offer ‘point-of-care’ diagnostic abilities that could revolutionize medicine.

To highlight our interest in this exciting field, the July 27th issue of Nature contains an Insight (a collection of topical articles and reviews) which discuss the history, design, current applications, and the promising future of these 'lab-on-a-chip' devices:

The origins and the future of microfluidics (Whitesides)
Scaling and the design of miniaturized chemical-analysis systems (Janasek et al.)
Developing optofluidic technology through the fusion of microfluidics and optics (Psaltis et al.)
Future lab-on-a-chip technologies for interrogating individual molecules (Craighead)
Control and detection of chemical reactions in microfluidic systems (deMello)
Cells on chips (El-Ali et al.)
Microfluidic diagnostic technologies for global public health (Yager et al.)

There’s also a news story from Jenny Hogan on microreactors. (And you may want to check out 'Clicks and chips’ and Haswell’s recent News & Views article on Belder et al.)

For a complete list of Insights, click here - we hope you enjoy these reviews!

Joshua


Joshua Finkelstein (Associate Editor, Nature)

July 25, 2006

GRC: Ice ice baby

(Editor's note: at the request of the GRC, this post has been removed.)

Joshua Finkelstein (Senior Editor, Nature)

July 18, 2006

A penny for your thoughts


There's a pretty funny article on CNN.com today - it turns out that the cost of the United States one-cent coin (a.k.a. the 'penny') has been rising for the last few years. It is currently 97.6% zinc & 2.4% copper, and since the price of "zinc is up 76% this year [and the price of] copper is up 68%," the penny currently costs 1.4 cents to make.

So Representative Jim Kolbe wants to implement the Currency Overhaul for an Industrious Nation Act [COIN Act - clever, no?]. If passed, all "cash transactions ending in 1, 2, 6, or 7 cents [would] be rounded down to the nearest 5 cents, while transactions ending in 3, 4, 8, or 9 cents would round up. Credit and debit card transactions could still be valued to the nearest cent."

Two potential problems with this act? "Americans overwhelmingly want the penny ... They also hate rounding."

Joshua


Joshua Finkelstein (Associate Editor, Nature)

July 13, 2006

Toxins are busting out all over


When it comes to marine natural products, there's certainly no shortage of chemically-interesting, highly toxic molecules: for example, there's saxitoxin ("Exposure to saxitoxin might cause ... muscle weakness, vertigo, and cranial nerve dysfunction. Respiratory failure and death might occur from paralysis.") and brevetoxin ("Gastrointestinal symptoms include abdominal pain, vomiting, and diarrhea. Neurologic symptoms include paresthesias, reversal of hot and cold temperature sensation, vertigo, and ataxia. Inhalational exposure to brevetoxin results in cough, dyspnea, and bronchospasm.").

So ciguatoxin may seem quite mild by comparison: "symptoms include nausea, vomiting, diarrhea, cramps, excessive sweating, headache, and muscle aches. The sensation of burning or "pins-and-needles," weakness, itching, and dizziness can occur. Patients may experience reversal of temperature sensation in their mouth, ... unusual taste sensations, nightmares, or hallucinations. Ciguatera poisoning is rarely fatal."

It can be extremely challenging to isolate these molecules (for example, only "0.35 mg of ciguatoxin [was] extracted from 4000 kg of moray eels") and many of these molecules (and other marine toxins) have complex molecular architectures that have fascinated synthetic chemists for years.

Although maitotoxin (one of the largest and most toxic marine natural products) has not been synthesised (yet), many other marine toxins have been made in the lab: the synthesis of (+)-saxitoxin was described earlier this year (Fleming & Du Bois), brevetoxin A and B were synthesized years ago (brevetoxin A; brevetoxin B), and earlier this month, the syntheses of the two most toxic ciguatoxins (ciguatoxin and 51-hydroxyCTX3C) were reported in JACS (Inoue et al.). One highlight of the ciguatoxin synthesis involved a radical cyclization reaction which stereospecifically formed a key seven-membered ring in the middle of the molecule (the 'G' ring)...

But have no fear, not every natural product made by a marine organism is ultra toxic: Fuwa et al. just reported the synthesis of the proposed structure of brevenal, a pentacyclic polyether natural product. For some reason, this molecule actually "displaces tritiated dihydrobrevetoxin-B ... from voltage-sensitive sodium channels in a dose-dependent manner and acts as a natural brevetoxin antagonist in vivo."

After making the proposed structure, the authors noticed that "[u]nfortunately, 1H and 13C NMR data ... were not identical to those reported for the natural sample ... On the basis of these NMR variations, along with the proposed biosynthetic pathway for marine polycyclic ethers, we think that the correct structure of brevenal is most likely represented by the C26 epimer of the [molecule we synthesized]." But keep your eyes peeled for their next paper, as they say that "efforts toward structural determination and total synthesis of brevenal are underway and will be reported in due course."

Joshua


Joshua Finkelstein (Associate Editor, Nature)

July 07, 2006

Bring on the beer


You probably know someone with Celiac disease, as it affects approximately one out of every 250 people, who "cannot tolerate a protein called gluten, found in wheat, rye, and barley." (Others estimate that the prevalence of this disease is even higher, as it may be underdiagnosed in some populations.)

There's no cure for this disease, so people with Celiac disease must change their diet and avoid gluten for the rest of their life. This can be challenging (unless gluten-free labels appear on the food), because in addition to the obvious places, "gluten is also 'hidden' in many processed foods such as frozen French fried potatoes, soy sauce and rice cereal. Even many non-food items like cosmetics, and household cleansers contain gluten." The risk of cross-contamination from other foods can present problems when eating in restaurants or traveling, and beer lovers will need to switch to gluten-free beer...

In the June 26th issue of Chemistry & Biology, Siegel et al. determined that two enzymes (a glutamine-specific cysteine protease from barley and a prolyl endopeptidase) could be used to degrade gluten in an acidic environment - neither enzyme worked very well on its own, but the combination was able to detoxify "grocery store gluten ... within 10 min of simulated duodenal conditions."

The hope is that these enzymes could be taken orally by someone with Celiac disease before eating (like Lactaid for lactose-intolerant people), helping them "cope with the 'hidden' gluten in everyday life ... [and enabling them to] resume a more normal diet."

Joshua


Joshua Finkelstein (Associate Editor, Nature)

Save the date


If you're free in early November, you might want to attend the 2006 Nature Chemical Biology Symposium, which will be on November 10th & 11th at the Museum of Science in Boston.

The meeting's focus is the "frontier of in vivo chemical biology" and there are five sessions:

The nucleus and cell division
Metal ions and metabolites
Cytoplasmic processes
Membranes
Cell and chemical biology moving forward

Carolyn Bertozzi and James Rothman are the Keynote Speakers, and the rest of the program really looks fantastic...

Hope to see you there...

Joshua


Joshua Finkelstein (Associate Editor, Nature)

July 06, 2006

Don't call it a comeback...


There's been quite a bit of buzz about a recent Nature Chemical Biology paper from Chong et al. (the work was featured in CE&N, Chemistry World, and Reuters.com). The authors created a library of 2,687 existing drugs and screened them for inhibitors of the malaria parasite Plasmodium falciparum. ("The [Johns Hopkins Clinical Compound Library] contains 1937 drugs that have been approved by the US Food and Drug Administration (FDA), along with 750 drugs that have either been approved for use in other countries or are undergoing Phase II clinical trials.")

The main idea is that if the authors could find a relatively potent inhibitor of multidrug-resistant parasites, the compounds could be put into human clinical trials very quickly (since many of the compounds are already FDA-approved for human use). In fact, you may have already taken astemizole, which was "introduced in 1983 under the brand name Hismanal as a nonsedating selective H1-histamine receptor antagonist for treating allergic rhinitis and was sold in 106 countries [over the counter]."

Chong talked about this work at the ASBMB meeting a few months ago - Jennifer Kohler wrote a Meeting Report in the June issue of Nature Chemical Biology, in which she said:

The goal of the initiative is to facilitate the rapid discovery of new treatments for urgent unmet needs and to do so at a reduced cost ... By focusing on approved compounds, they hope to avoid much of the time and expense associated with developing a new chemical entity into a drug ... Chong is optimistic that use of this library may provide a facile route to desperately needed treatment options for malaria and other diseases of the developing world.

I think that most people would agree that new drugs are desperately needed to combat malaria (and many other diseases that disproportionately affect people living in the developing world). But the "appropriate" relationship between academic research and drug discovery/development is hotly debated - some people think that it is possible for academic scientists and drug companies to work together to develop new drugs. For example, Sanchez-Serrano recently wrote that "[t]he success of [the cancer drug] bortezomib was ultimately due to the tenacity of the people involved and the close collaboration ... between academia, the private sector, private investors, public institutions and advocacy groups." And Lunn & Stockwell wrote that (with respect to orphan genetic diseases) "academics, nonprofit organizations, and industrial groups can work together to develop the equipment, technologies, and assays needed for investigating these devastating and neglected human diseases." But other scientists feel that academics should focus on "pure" research problems and leave the discovery and development of drugs to the professionals...

What do you think about this debate? Should NIH (or other government) funds be spent trying to discover/develop new drugs? Do you think that academic scientists can help pharmaceutical companies discover new drugs? (If so, what do you think academics can bring "to the table"?)

Joshua


Joshua Finkelstein (Associate Editor, Nature)

June 15, 2006

Bruce Merrifield


I'm sure many of you know that Bruce Merrifield passed away a few weeks ago. In today's issue of Nature, Stephen Kent wrote an obituary describing Merrifield and his accomplishments.

If your institution subscribes to the ACS archives, you can download "Solid Phase Peptide Synthesis. I. The Synthesis of a Tetrapeptide" (you should be able to download the first page for free). According to C&EN, this was the "fifth most cited paper in the journal’s 125-year history."

You may also want to take a look at Gutte's & Merrifield's classic 1971 JACS paper, in which they reported the synthesis of ribonuclease A (124 amino acids long: this "required 369 chemical reactions and 11,931 steps of the automated peptide synthesis machine without any intermediate isolation steps.")

Merrifield also wrote two reviews in Science (in 1965 and 1986) - they're both pretty interesting reviews (and it's amazing to see how much changed in those 21 years...)

Joshua


Joshua Finkelstein (Associate Editor, Nature)

June 08, 2006

Twisting the night away


In today's issue of Nature, Tani & Stoltz reported the first chemical synthesis, isolation, and full characterization of 2-quinuclidonium tetrafluoroborate: at first glance, you might think that this molecule would be easy to synthesize, as it's quite small. But the amide bond is highly twisted (it is an 'anti-Bredt' amide: it violates Bredt's rule), which makes this molecule very susceptible to amide hydrolysis. Harry Wasserman wrote the accompanying News & Views article, in which he says:

Amides are surprisingly robust compared with structurally related derivatives, and it is believed that this linkage gains stability from electron 'delocalization' ... In circumstances where such coplanarity cannot be achieved without distortion of the structure, as would be the case with 2-quinuclidone (Fig. 1b), stabilization of the amide bond by electron delocalization is inhibited. Such twisted amides demonstrate unusually reactive chemical behaviour compared with typical amide bonds.

He then continues:

In 1941, during his studies on the synthesis of quinine, the young Harvard investigator (and eventual Nobel prizewinner) Robert B. Woodward thought deeply about the reactivity expected of this type of distorted amide. As one of his first graduate students, I was given the problem of synthesizing 2-quinuclidone. Originally, this research was largely of academic interest, but a few years later the expected chemical behaviour of twisted amides became an important issue in the determination of the structure of penicillin.

Stoltz said that he first learned about this molecule when he was house-sitting for Wasserman during graduate school. A few years later, EJ Corey mentioned the molecule to Stoltz (who was doing post-doctoral research in Corey's laboratory), calling it a "classic unsolved problem in synthesis."

If you're interested in learning more about this molecule, you can download the CIF file from the Cambridge Crystallographic Data Centre and take a closer look at this highly-strained amide bond...

Joshua


Joshua Finkelstein (Associate Editor, Nature)

June 06, 2006

You down with NNB? (Yeah you know me...)


Earlier today, the beta site of Nature Network Boston went 'live':

Nature Network Boston is the online meeting place for you and fellow Boston scientists to gather, talk and find out about the latest local scientific news and events ... We believe that science benefits from local interactions and collaborations ... [b]ut do you really know what that lab down the street is actually doing? Nature Network Boston will help you find that out. We aim to foster new ways for you to meet and get to know your neighbors.

The website has local (scientific) news, a list of events and scientific talks in the Boston area, and blogs from local scientists. It's free to join NNB - though you'll need to register to create your own personal profile page, post comments on the blogs, or form or join groups to network with other scientists. If you're feeling creative, you can apply to write a blog yourself...

They're going to add a number of new features in the coming months, so if you have any suggestions you can contact Corie Lok, the editor of the site...

Joshua


Joshua Finkelstein (Associate Editor, Nature)

June 05, 2006

OK Computer


Chemical & Engineering News published a brief news story today on Ashworth et al., which appeared in the June 1st issue of Nature. In that paper, the authors showed that computational protein design could be used to alter the specificity of the homing endonuclease I-MsoI. The redesigned enzyme was highly active and it cleaved the new recognition sequence about 10,000 times more effectively (in vitro) than the wild-type enzyme.

Earlier this year, David Liu's laboratory demonstrated that it was possible to use directed evolution to modify the specificity of another homing endonuclease (I-SceI), but Ashworth et al. is the first paper in which computational protein design was successfully used to modify the specificity of a homing endonuclease.

The authors say that "the method should be generalizable to any protein–DNA interface redesign problem: for example, the reprogramming of transcription factor binding specificity" and they believe that "[t]he use and refinement of the computational modelling and design strategies described here should ... [enable them to design] novel proteins [that are] able to recognize and cleave any desired DNA site with high specificity for targeted genomics applications."

Joshua


Joshua Finkelstein (Associate Editor, Nature)

It's all about the Benjamins


I thought some of you might want to know about a new source of funding for scientists who plan on attending a Gordon Research Conference in 2006:

The Nature Publishing Group (NPG) supports the broadest possible participation of qualified scientists in scientific conferences. To forward this goal NPG has established the NPG Awards to help assuage one of the factors that prevents conferees from various countries with developing economies from attending the renowned Gordon Research Conferences. NPG has provided limited funds for individuals from developing nations to attend Gordon Research Conferences in 2006. Applicants from all nations/regions are eligible, except those nations/regions listed below. [click here to see the list of non-eligible countries]

You need to be accepted to a 2006 GRC in order to apply for funding, and you could get up to $1,500...

Joshua


Joshua Finkelstein (Associate Editor, Nature)

June 01, 2006

Summertime


It's about 85 degrees in Boston and I got a sunburn walking into work - this means that the summer is officially here. OK - I know the first day of summer is still a few weeks away, but the sun is shining and it's time for me to start thinking about summer conferences.

If you say the words 'summer conference' to a group of scientists, I bet many of them think of the Gordon Research Conferences: you are whisked away with 100-150 other scientists to hear about exciting (and often unpublished) research for several days. Many of these conferences are in high schools or small colleges in New England, but don't let the Spartan accommodations or the cafeteria food deter you from coming - I've only been to a few GRCs, but I've had a fantastic time at every one...

This summer I'm 99% sure I'll be attending the Natural Products GRC and the Bioorganic GRC - I'd love to go to the Enzymes, Coenzymes & Metabolic Pathways GRC and the Organometallic GRC, but I'd be out of the office for the month of July, and I don't think our authors (or my wife) would really like it if I was gone that long. Maybe next year the conference organizers will spread them out a bit...

Other summer conferences that look good include the RSC Organocatalysis conference (in early July), EuroBIC (also in early July), and the annual Protein Society meeting (in early August).

What conferences are you going to this summer? We're always interested in hearing about exciting conferences, so if you've been to that conference in previous years, why do you like it? What keeps you coming back? (And please feel free to shamelessly promote a conference you're organizing...)

If you're at any of these conferences, keep an eye out for me - maybe we can chat about your research over a pint or two...

Joshua


Joshua Finkelstein (Associate Editor, Nature)

May 31, 2006

The safety dance


- Derek Lowe's blog entries in the "Things I Won't Work With" category
- the explosion at the National Institution of Higher Learning in Chemistry at Mulhouse (which killed chemistry professor Dominique Burget)
- Karen Wetterhahn's tragic death in 1997

Chemistry just seems more dangerous than other scientific disciplines...

In the June 1st issue of Nature, Mark Peplow and Emma Marris investigated whether or not chemistry deserves its "reckless reputation." They talked with a number of safety officers from several universities, many of whom think that the dangers of chemistry are a bit exaggerated:

"A lot of it is reminiscence to 'the good old days' of chemistry," says Alan Kendall, safety officer at the University of Oxford, UK.
"There's a public perception that is years behind the reality," agrees Richard Firn, a biologist who chairs the laboratory safety committee at the University of York, UK. "Things have changed a lot in the past 10 to 15 years" ... "People's risk perception is skewed by the drama of an explosion" ...

But Mark and Emma acknowledged that it was "surprisingly difficult to get national statistics on scientific accidents ... [the UK Health and Safety Executive], for example, groups all its accident figures for schools, colleges and universities into a single number, making it difficult to discern safety trends or to tell if one type of lab is more risky than another."

Joshua


Joshua Finkelstein (Associate Editor, Nature)

The days of wine and cheeses


This month's issue of Wired magazine has two stories that have to do with chemistry - there's an article on the chemistry of cream cheese, which contains the following (choice) quote:

[John] Lucey is an associate professor of food science at the university and runs the cream cheese program. Born in Ireland, he came to Wisconsin for a professorship after making his name in yogurt research in Europe. [emphasis added]

For those of you who are interested in learning more about the field, you might want to check out a recent review article by Johnson & Lucey entitled "Major technological advances and trends in cheese."


There's also a story on the challenges of DIY chemistry in the post-9/11 world - it even has a few experiments to get you started (including how to make a stink bomb from wooden safety matches and household ammonia...) Though I'm not entirely sure the EPA would recommend this (after performing the "Lavalicious" experiment): "Transfer the chromium oxide to the widemouthed jar, seal, and discard."

This part of the article is a bit alarming/depressing:

More than half of the suggested experiments in a multimedia package for schools called “You Be the Chemist,” created in 2004 by the Chemical Educational Foundation, are to be performed by the teacher alone, leaving students to blow up balloons (with safety goggles in place) or answer questions like “How many pretzels can you eat in a minute?" ... “We want to give kids lessons that tie in to their real-world experiences without having them deal with a lot of strange chemicals in bottles that have big long names.”

This might explain why the number of B.Sc. chemists has been steadily decreasing since the mid-90s...

Joshua


Joshua Finkelstein (Associate Editor, Nature)

May 30, 2006

Everything bad is good again


One of my favorite scenes in Woody Allen's 1973 film Sleeper involves two doctors (for those of you who haven't seen this film, most of the movie takes place in the year 2173):

Dr. Melik: [puzzling over list of items sold at Miles' old health-food store] ... wheat germ, organic honey and ... tiger's milk.
Dr. Aragon: Oh, yes. Those are the charmed substances that some years ago were thought to contain life-preserving properties.
Dr. Melik: You mean there was no deep fat? No steak or cream pies or ... hot fudge?
Dr. Aragon: [chuckling] Those were thought to be unhealthy ... precisely the opposite of what we now know to be true.
Dr. Melik: Incredible!

I thought of this scene when I first heard about the possible beneficial properties of red wine (back in 1992, when Siemann & Creasy proposed that resveratrol might be responsible for the cardioprotective effects of red wine). Although I drink quite a bit of red wine, I hadn't really thought much about resveratrol until I read a new review article by Baur & Sinclair that's on the Nature Reviews Drug Discovery Advance Online Publication page.

Since that original report back in 1992, the number of papers exploring resveratrol's biological activity has skyrocketed: according to Baur & Sinclair resveratrol has been shown to "prevent or slow the progression of a wide variety of illnesses, including cancer, cardiovascular disease and ischaemic injuries, as well as enhance stress resistance and extend the lifespans of various organisms from yeast to vertebrates."

Not a big fan of red wine? No problem - there are many other natural sources of resveratrol, including grape juice, blueberries, and pistachios (although the concentration of resveratrol is much higher in red wine...)

We still need to learn more about the physiologically-relevant mechanism(s) of action, and the authors suggest that "blocking the metabolism of resveratrol, developing analogues with improved bioavailability, or finding new, more potent compounds that mimic its effects" will be important, as resveratrol is not cheap: "administering a daily dose to a human weighing 75 kg with 100 mg per kg (body weight) of resveratrol would require 2.7 kg of resveratrol a year, at a current cost of about US$6,800."

This blog entry has made me thirsty for some wine tonight - I think I'll stop off at the wine store on the way home and pick up a nice Syrah or maybe a bottle of French wine - anything red is fine, as long as it's not a Merlot...

Joshua


Joshua Finkelstein (Associate Editor, Nature)

May 24, 2006

Happy birthday, Nature Chemical Biology!


Nature Chemical Biology is now one year old, and the editors have put together a special anniversary issue to celebrate: in addition to the usual selection of exciting primary research, this issue has a meeting report by Jennifer Kohler on the recent American Society for Biochemistry and Molecular Biology meeting (which had a great series of talks in the "Chemical Genetics and Drug Discovery" section) and a review article by Jason Chin on synthetic biology. (If you're interested in synthetic biology, you might want to check out the Nature Newsblog for Oliver Morton's thoughts on the Second International Conference on Synthetic Biology.)

This special issue has a new section called "Elements," which "will feature interviews with key people in the chemical biology community and offer insights into places or events that are of general interest to chemists and biologists." In this issue, Joanne Kotz talks with Harvard Professor Jeremy Knowles.

Lastly, the editorial team at Nature Chemical Biology has put together a selection of papers from their first 12 issues, all of which are free for the month of June.

Joshua


Joshua Finkelstein (Associate Editor, Nature).

May 19, 2006

Ask an expert


If you're an organic chemist, you've probably already seen this blog entry, but for those of you who don't read Tenderbutton regularly, you should check it out. Dylan Stiles is a graduate student in the Trost group at Stanford, and a few weeks ago, 'Ask Tenderbutton' was conceived: you can send in your chemistry question/problem and Dylan will try to answer it/give you some advice. In addition, you'll also get plenty of suggestions from his regular readers - 'Debenzylating in Despair' has already received 20 comments from Dylan's readers. The best part: Dylan's asked people to write their questions in the cheesy 'Dear Ann Landers' style (hence the letter from 'Debenzylating in Despair'...)

I think this is a fantastic idea - there are lots of universities where you can't swing by another lab and talk with someone who developed the catalyst you're using or someone who might be able to give you some quick advice that can save you a few weeks of trial and error. This is especially true for chemists who are in laboratories at medical schools - the chemistry department might be across town... And since there are all sorts of little tricks that mean the difference between 20 and 90% yield, blogs might be the best way to quickly tap into a broad range of experts...

For some reason Dylan's entry reminded me of the InnoCentive project that was started a few years ago - I hadn't checked that site for a few years (and didn't know if the project was still running), but there are still a number of 'Challenges' in the chemistry and biology categories. With the long weekend coming up, maybe it's worth sitting down and taking a crack at some of those problems: for many of the challenges, the prize money is between 10,000 and 50,000 dollars (and I'd love a 61'' HDTV...)

Joshua


Joshua Finkelstein (Associate Editor, Nature)

May 12, 2006

I am the Lorax. I speak for the trees...


While flipping through yesterday's issue of Nature, I came across the special report on toxicology/toxicologists in the Naturejobs section... After struggling to get that infernal Britney Spears song out of my head, I read through the article, which really made toxicology sound like an interesting career...

Ricki Lewis wrote that a "career in toxicology might take a scientist to a contaminated well, a crime scene, a courtroom, an analytical chemistry lab or a political hearing" and "it isn't uncommon for a seasoned scientist to have spent time in academia, industry and government, and finish with private consulting." Considering how successful shows like CSI and Numb3rs are, I'm a bit surprised that no one's produced a prime-time TV drama starring toxicologists (I can see it now - EPA: Risk Assessment Unit...)


There's also a nice News & Views article by Robert Crabtree on a recent Science paper from the Goldman and Brookhart laboratories - in the presence of an iridium catalyst and a Schrock metathesis catalyst, the authors reported that a tandem alkane dehydrogenation/olefin metathesis reaction could be used to elongate inert hydrocarbon chains (technically, it's a tandem alkane dehydrogenation/olefin metathesis/alkane hydrogenation reaction, but that's a bit of a mouthful...)

The authors hope that this system could be used "turn coal, leftover oil refinery products or even plants into diesel fuel and other functional hydrocarbons." But Professor Brookhart acknowledged that "considerable improvements in the catalyst systems are required before they become practical."

Joshua


Joshua Finkelstein (Associate Editor, Nature)

May 08, 2006

Doing the worm...


Despite its small size (about one millimeter long), the nematode Caenorhabditis elegans has been used to study a wide range of "biological processes including apoptosis, cell signalling, cell cycle, cell polarity, gene regulation, metabolism, ageing and sex determination." Which is pretty amazing, as it truly is a simple organism: the adult hermaphrodite has 959 somatic cells!

In the May issue of Nature Reviews Drug Discovery, Kaletta & Hengartner wrote:

The cellular complexity and the conservation of disease pathways between C. elegans and higher organisms, together with the simplicity and cost-effectiveness of cultivation, make for an effective in vivo model that is amenable to whole-organism high-throughput compound screens and large-scale target validation.

I was surprised to learn that complex diseases can be investigated using this worm - scientists are even using it to "identify additional mode of actions of fluoxetine [an antidepressant] and to further elucidate the molecular mechanism of depression."

C. elegans is getting a lot of attention at NPG this week: in the May 4th issue of Nature, Kwok et al. screened 14,100 small-molecules in living worms and identified 308 compounds that induced a range of phenotypes, including slow growth, lethality, uncoordinated movement and morphological defects. One of these small-molecules (a 1,4-dihydropyridine that they named nemadipine-A) induced an Egl phenotype (egg-laying defects).

The authors then screened 180,000 "randomly mutated wild-type genomes" to look for dominant genetic suppressors of the nemadipine-A-induced phenotype, and they performed a number of follow-up experiments that indicated that the protein Egl-19 (the only L-type calcium channel alpha1-subunit in C. elegans) is a target of nemadipine-A.

This isn’t completely unsurprising, as other 1,4-dihydropyridines are known to "antagonize the alpha1-subunit of L-type calcium channels"), but it's an important demonstration that C. elegans can be used to quickly identify the targets of biologically active small-molecules - to quote Professor Randall Peterson, "[t]arget identification has been one of the thorniest problems in small-molecule screening, so this is a welcome and encouraging advance." And it's so simple, Professor Peter Roy (the lead author of the study) said "I could teach a first-year undergrad to do it"...

Joshua


Joshua Finkelstein (Associate Editor, Nature)

May 01, 2006

TCTTGTGAACCTACTATTTGTGCTCTTTGTCATTATATGATTTCTACT


It seems like every week there's some amazing new development involving 'lab on a chip' devices: in the May 9th issue of PNAS, Blazej et al. reported a nanoliter-scale microfabricated bioprocessor that was able to perform all three Sanger sequencing steps.

The device "incorporates a range of advanced lab-on-a-chip technologies, including miniaturized temperature sensing, nanoliter-scale Sanger extension reactions, microvalves/pumps, DNA affinity-capture, and high-performance CE." Like many other lab-on-a-chip devices, it's remarkably small (100 mm diameter) and the authors were able to sequence 556 continuous bases from 1 femtomole of a DNA template (with 99% accuracy).

Only 10e-15 moles of template? That's amazing! (And the raw sequencing data in Figure 4 looks fantastic...)

Since a "reaction containing 1 fmol of template generates [approximately] 26 times more product than is needed for detection,” the authors believe that they could run the reaction with only 100 attomoles of the DNA template. If this was done, “a sequencing reaction performed at standard concentrations in an easily fabricated 25-nl reactor [would represent] a 400-fold reduction in current sequencing reagent consumption.”

This is bound to make the NIH happy: "it still costs about $10 million to sequence 3 billion base pairs" and "NHGRI's near-term goal is to lower the cost of sequencing a mammalian-sized genome to $100,000, which would enable researchers to sequence the genomes of hundreds or even thousands of people as part of studies to identify genes that contribute to common, complex diseases." One of their long-term goals is to find a way to sequence a human-sized genome for $1,000 or less.

But the $1,000 genome would come with potential ethical concerns - I don't know about you, but I don't think I'd want my genome sequenced... I guess it would be good to know if I was genetically predisposed to get cancer or heart disease so I could take steps to prevent it, but part of me thinks that I'll enjoy life a bit more being blissfully ignorant... And what if the markers they discover are only right 90% of the time? Then I'd worry away my adulthood only to die of something else...

If you could get your genome sequenced during your next check-up, would you do it?

Joshua


Joshua Finkelstein (Associate Editor, Nature)

April 28, 2006

Why did the chicken cross the road?


With H5N1 avian influenza gradually making its way across the world, a lot of people are preparing for the worst. It's still not clear if this strain of the flu will 'evolve the ability to spread between people,' but if this happens, we're in for some serious problems:

Supplies of vaccines and antiviral drugs – the two most important medical interventions for reducing illness and deaths during a pandemic – will be inadequate in all countries at the start of a pandemic and for many months thereafter ... WHO has used a relatively conservative estimate – from 2 million to 7.4 million deaths – because it provides a useful and plausible planning target. This estimate is based on the comparatively mild 1957 pandemic. Estimates based on a more virulent virus, closer to the one seen in 1918, have been made and are much higher.

The current syntheses of oseltamivir (a.k.a. Tamiflu) fall 'short of the ideal for several reasons: (1) the starting point in the synthesis is either (-)-shikimic or (-)-quinic acid, which are complex relatively expensive and of limited availability, and (2) two steps involve potentially hazardous and explosive azide-containing intermediates.'

But two new syntheses of oseltamivir/Tamiflu were reported in JACS earlier this week: one is by Yeung et al. and the other is by Fukuta et al.

Although the synthesis from Corey's group is much shorter, both syntheses avoid using either (-)-shikimic or (-)-quinic acid as starting materials: Corey's synthesis starts with 1,3-butadiene and trifluoroethyl acrylate and Shibasaki's synthesis starts with the asymmetric ring-opening reaction of a meso-aziridine with TMSN3. If these syntheses could be scaled up and optimized further, it might be possible to reduce the cost of oseltamivir/Tamiflu and pharmaceutical companies (or paranoid graduate students) could make plenty of the compound, which could be stockpiled and used if a human pandemic occurs.

The only catch: oseltamivir-resistant virus has already been reported in Vietnam...

Joshua


Joshua Finkelstein (Associate Editor, Nature)

April 27, 2006

And the Oscar goes to...


The National Academy of Sciences and the American Academy of Arts & Sciences have announced their new members: '72 new members and 18 foreign associates from 16 countries' for the NAS (including David Baker, Eric Heller, and Nobel Laureate Harold Kroto) and '175 new Fellows and 20 new Foreign Honorary Members' for the AAAS (including Dale Boger, Amos Smith III, and Timothy Swager).

This announcement comes only a few weeks after Howard Hughes Medical Institute released the names of their new 'million-dollar professors' (including Catherine Drennan, Scott Strobel, and Richard Zare).

On behalf of everyone at Nature, congratulations!

Joshua


Joshua Finkelstein (Associate Editor, Nature)

April 14, 2006

I like to move it, move it...


In today's issue of Science, there's a nice review on protein dynamics by Mittermaier & Kay and a paper on the dynamics and function of a peptidyl carrier protein domain of tyrocidine A synthetase. In their review, Mittermaier & Kay wrote:

Recent methodological advancements in NMR have extended our ability to characterize protein dynamics and promise to shed new light on the mechanisms by which these molecules function ... NMR spectroscopy is uniquely suited to study many of these dynamic processes, because site-specific information can be obtained for motions that span many time scales, from rapid bond librations (picoseconds) to events that take seconds.

Although I'm sure X-ray crystallography will still be widely used to determine the three dimensional structures of proteins in the future, I think we'll start to hear more about the utility of NMR spectroscopy, especially since there are a number of NIH-funded structural genomics centers that are using NMR spectroscopy to solve protein structures, there are new labeling methods that may make it possible to use NMR to solve the structures of larger proteins, and there are exciting demonstrations of how solid-state NMR can be used to probe the structure and function of membrane proteins.

NMR can also be used to find important biologically active small-molecules/potential drugs - for example, Oltersdorf et al. used NMR to find and optimize a new anti-cancer compound and Forino et al. used a "fragment-based approach" to find a new inhibitor of the lethal factor metalloproteinase from Bacillus anthracis.

Of course, many of these experiments can't be done on an aging NMR spectrometer. In a recent Nature paper, Dorothee Kern's group used a Varian 800-MHz spectrometer to examine the dynamics of the prolyl cis-trans isomerase cyclophilin A. 800-MHz spectrometers will need to get a lot cheaper before many laboratories can afford to use them routinely...

Joshua


Joshua Finkelstein (Associate Editor, Nature)

April 13, 2006

Gentlemen, we can rebuild yeast. We have the technology…


If you're a regular reader of Chemical & Engineering News or the BBC News website, you've probably already heard about an exciting paper in yesterday's issue of Nature by Ro et al.

The authors were able to re-engineer S. cerevisiae to produce fairly large amounts of artemisinic acid, a precursor to the anti-malarial drug artemisinin (up to 100 mg per liter of culture). The authors used a novel cytochrome P450 monooxygenase from A. annua to perform a three-step oxidation of amorpha-4,11-diene to artemisinic acid, which can be chemically converted to artemisinin. Malaria kills more than one million people each year, and artemisinin is a highly effective, but costly, treatment. If this process could be scaled up and optimized, the authors "project that artemisinin or its derivatives could be produced at costs significantly below current prices, thereby lowering the cost of an artemisinin combination therapy by a significant amount."

This work was funded by a $42.6 million grant from the Bill & Melinda Gates Foundation, which was was awarded to the California Institute of Quantitative Biomedical Research at University of California, Berkeley, Amyris Biotechnologies, and the Institute for OneWorld Health (a non-profit pharmaceutical company). It's an interesting collaboration:

To ensure affordability, UC Berkeley has issued a royalty-free license to both OneWorld Health and Amyris to develop the technology to treat malaria. Amyris will transform the Keasling lab's research into a robust fermentation process and perform the chemistry and scale-up necessary to bring the drug to market. OneWorld Health will conduct pre-clinical studies and implement a global access strategy for the drug.

If you want to learn more about the work, Jay Keasling was interviewed on this week's podcast and there's a news story in the April 13th issue of Nature by Narelle Towie.

Joshua


Joshua Finkelstein (Associate Editor, Nature)

April 11, 2006

Crystal clear...


OK - I know this is going to sound strange, but I really love looking at electron density... Most structural papers have a few figure panels showing some electron density (usually the active site residues), but atomic resolution structures are rare and it's just so satisfying to see little globes of density around each atom (rather than a big blob that could represent one of several rotomers...)

If you love electron density too, there's a recent paper from Nature Chemical Biology that might interest you: Lyubimov et al. "obtained five sets of X-ray diffraction data at atomic resolution (0.92–0.99 [Angstroms]) over a broad pH range (4.5, 5.2, 5.8, 7.3 and 9.0)." And Figures 1, 2, and 4 are beautiful... (If you don't currently subscribe to that journal, the paper's graphical abstract has a taste of what you're missing...)

This isn't the first atomic resolution X-ray crystal structure of a protein - there's also a 1.0 Angstrom structure of cutinase from Longhi et al., a 0.78 Angstrom structure of subtilisin from Kuhn et al., a 0.95 Angstrom structure of a pancreatic elastase/N-acetyl-Asn-Pro-Ile-CO2H complex from Katona et al., a a series of atomic resolution structures of RNase A from Berisio et al., and a 0.95 Angstrom structure of cholesterol oxidase from Lario et al.

Lyubimov et al. remind us that "[i]n 1936, Mirsky and Pauling wrote, 'The importance of the hydrogen bond in protein structure can hardly be overemphasized'" - I'm sure that Mirsky and Pauling would be really interested to read the aforementioned papers, as we are now able to examine the role of hydrogen atoms in enzymatic catalysis for fairly large proteins (cholesterol oxidase is 56 kDa, for example).

Hopefully this field will continue to grow and we'll see more atomic resolution structures in the RCSB Protein DataBank - I don't know about you, but I'd love to see a 0.9 Angstrom structure of the ribozyme in action...

Joshua


Joshua Finkelstein (Associate Editor, Nature)

April 03, 2006

Mind if I cut in?


There are a number of papers that have described catalytic asymmetric C-H insertion reactions (see a recent review on catalytic intramolecular C-H aminations by Davies & Long), but there are only a few examples of asymmetric O-H insertion reactions. In the ASAP section of the Journal of the American Chemical Society, Maier & Fu reported the first "effective" method for catalytic enantioselective insertions into O-H bonds.

The authors showed that in the presence of copper and a chiral bisazaferrocene ligand, various alcohols reacted with methyl alpha-diazo-alpha-phenylacetate, yielding alpha-alkoxy esters (the best yields and ee were achieved using methanol, 2-trimethylsilylethanol, or para-methoxybenzyl alcohol). They further explored the scope of the reaction involving 2-trimethylsilylethanol and demonstrated that they could isolate a range of alpha-diazo-alpha-arylacetates in high yields and ee - since the trimethylsilylethyl group can be easily removed using boron trifluoride diethyl etherate, the authors could also obtain enantiomerically pure alpha-hydroxy esters in high yields and ee.

Joshua


Joshua Finkelstein (Associate Editor, Nature)

March 29, 2006

ACS: Under pressure...


Earlier today, Professor John Bercaw talked about the kinetics and mechanism of methane C-H activation via electrophilic platinum complexes. They used sapphire NMR tubes to analyze methane activation kinetics at extremely high pressures (300-1000 psi of methane in the paper, but Bercaw mentioned that they safely could go up to 3000 psi).

In their recent JACS paper, Owen et al. acknowledged "Dan Nieman, Dean Roddick, Steve Olson, Mike Roy, David Law, Glenn Sunley, and Marc Payne for assistance with design and construction of the high-pressure NMR equipment." I've scoured the Bercaw group homepage and the internet trying to find a picture of this device, but I wasn't able to find one...

What's your favorite device that was constructed to address a scientific problem? Maybe Professor Patrick Brown's cDNA microarrayer? Or one of Professor George Whitesides's self-assembled (functional) electronic devices? Or Professor Peter Seeberger's solid-phase oligosaccharide synthesizer?

Joshua


Joshua Finkelstein (Associate Editor, Nature)

March 28, 2006

ACS: Groove is in the Hartwig...


This morning, Professor John Hartwig was awarded the "ACS Award in Organometallic Chemistry." In his talk, he discussed a number of recent results from his laboratory, including the insertion of an iridium complex into an N-H bond of ammonia, the intermolecular hydroamination of vinylarenes, an iridium catalyst able to perform enantioselective allylic aminations, and some of his recent mechanistic studies of the palladium-catalyzed amination of aryl halides (a collaboration between Hartwig's group, Donna Blackmond's group at Imperial College, and Stephen Buchwald's group at the Massachusetts Institute of Technology.

Earlier in the session, Robert Bergman talked about some of the work his group has done (in collaboration with Kenneth Raymond's group) which involved C-H bond activation of aldehydes using an iridium catalyst and guest/host chemistry - maybe it's just Hartwig's and Bergman's enthusiasm rubbing off on me, but I think that iridium (which was "named after the Latin word for rainbow (iris ...) because many of its salts are strongly colored") might be my new favorite transition metal...

Joshua


Joshua Finkelstein (Associate Editor, Nature)

March 27, 2006

ACS: Looking for data in all the right places...


PubChem was created in 2004 as part of the NIH Roadmap - it was intended to be a "new and comprehensive database of chemical structures and their biological activities ... [which would contain] compound information from the scientific literature as well as screening and probe data from the [Molecular Libraries Screening Center Network]."

Nature Chemical Biology was one of the first journals to deposit chemical structures into this database, and according to Stephen Bryant, the amount of data is rapidly growing: the database now contains over five million unique structures and more than 190 bioassays.

It sounds like this database will make it easier for chemists and biologists to find interesting bioactive small-molecules. And the best part? Like PubMed, the data is freely available to the entire scientific community...

Joshua


Joshua Finkelstein (Associate Editor, Nature)

ACS: Highway to Heck...


Earlier this morning, Professor Larry Overman gave a talk in a session honoring Professor Richard Heck's contributions to organopalladium chemistry.

Overman talked about intramolecular Heck reactions, and he highlighted the stereocontrolled total synthesis of (+/-)-gelsemine, the enantioselective total synthesis of (+)-minfiensine, and discussed an unpublished synthesis of guanacastepene N.

If you're looking for some of his work that's "hot off the press," there are two recent papers in Organic Letters from Overman & Watson: "Diastereoselection in the Formation of Spirocyclic Oxindoles by the Intramolecular Heck Reaction" and "Diastereoselection in the Formation of Contiguous Quaternary Carbon Stereocenters by the Intramolecular Heck Reaction."

The session was packed, and Overman certainly convinced me that intramolecular Heck reactions are a powerful way to make contiguous quaternary carbon stereocenters, even "in situations of considerable steric congestion." If you were there, what did you think?

Joshua


Joshua Finkelstein (Associate Editor, Nature)

March 26, 2006

ACS: The life aquatic with William Fenical


In The Ocean World, Jacques-Yves Cousteau wrote

From the vast expanses of its surface waters to its beaches and marshes and tidelands and mangrove swamps, from its many thousands of miles of rocky shores to its deepest and darkest abyss, the sea produces life in fantastic abundance.


Cousteau’s aquatic adventures ran through my mind when I ate lunch after Professor William Fenical's talk this morning. He was awarded the "Guenther Award in the Chemistry of Natural Products" and spoke about marine actinomycetes, microorganisms whose terrestrial cousins produce a number of natural products, including streptomycin and actinomycin.

Fenical thought that microorganisms capable of producing interesting, biologically-active natural products lived in the ocean. To find these microbes, his research group constructed new devices to collect samples from the deep sea: the “mud snapper” (200 meters deep), electric reels (1500 meters deep), and an autonomous sampling device that looked like a cross between a syringe and a pogo stick (6000 meters deep). He showed a movie of this last device: it sinks to the bottom of the ocean and the tip of the device plunges into the sediment and collects a soil sample. Then it releases its weights and shoots back up to the surface, where the samples can be retrieved and brought back to the lab.

A few years ago, his research group reported the discovery of a new marine actinomycetes (Salinospora), which produced salinosporamide A, a natural product with a fused gamma-lactam-beta-lactone bicyclic ring structure. They showed that in vitro, this compound was highly potent against a number of cancer cell lines.

Chauhan et al. recently published a Cancer Cell paper where they showed that this compound (renamed NPI-0052) was orally bioavailable and that it prolonged survival in animal tumor model studies. For these reasons, salinosporamide A/NPI-0052 is now scheduled to enter human clinical trials in the late spring or early summer.

In a Chemical & Engineering News article written earlier this year, Fenical said

Oceans not only cover more than 70% of Earth's surface, but more than 90% of the organisms in the ocean are not found on land … In one cubic centimeter of bottom sediment, there are 1 billion microbial organisms. There is a huge diversity of microscopic organisms [that may produce] potent, biologically active metabolites of unique, unprecedented structures.


Fenical's research group has identified and cultured 15 new marine phylotypes so far - including Salinispora pacifica, which was reported in a recent issue of Organic Letters and produces cyanosporasides A and B. This is only a fraction of what’s out there, but it looks like Fenical's research group is off to a good start...

Joshua


Joshua Finkelstein (Associate Editor, Nature)

March 23, 2006

NPG at the 2006 Spring ACS meeting


From March 26th to the 30th, we will be attending the 2006 Spring meeting of the American Chemical Society and have put together a special website that contains:

- a list of some of the sessions the editors will be attending


- a special edition of the Nature Podcast, in which Dr. Chris Smith talks with the authors of some of the most exciting chemical and biochemical content that has appeared in recent issues of Nature, Nature Reviews Drug Discovery, Nature Chemical Biology, Nature Materials, and Nature Methods. The six papers featured on the podcast are:

Folding DNA to create nanoscale shapes and patterns by Rothemund (Nature)
Structural basis for the spectral difference in luciferase bioluminescence by Nakatsu et al. (Nature)
Lab-on-a-chip: microfluidics in drug discovery by Dittrich & Manz (Nature Reviews Drug Discovery)
Trafficking in persulfides: delivering sulfur in biosynthetic pathways by Mueller (Nature Chemical Biology)
Liquid-crystalline semiconducting polymers with high charge-carrier mobility by McCulloch et al. (Nature Materials)
A monovalent streptavidin with a single femtomolar biotin binding site by Howarth et al. (Nature Methods)


- and a selection of 25 exciting chemistry papers from Nature, Nature Chemical Biology, Nature Materials, and Nature Methods that can be downloaded for free during the 2006 Spring meeting of the American Chemical Society. We hope you enjoy reading these papers as much as we did!


In addition, we will be at the NPG booth (#414) at the following days and times:

Allison Doerr (Assistant Editor, Nature Methods) - Monday, March 27th from 09.30 – 10.30
Joshua Finkelstein (Associate Editor, Nature) - Monday, March 27th from 12.00 to 13.00
Terry Sheppard (Chief Editor, Nature Chemical Biology) – Monday, March 27th from 15.00 to 16.00
Stuart Cantrill (Associate Editor, Nature Nanotechnology) - Tuesday, March 28th from 10.00 to 11.00
Emma Marris (Washington Correspondent, Nature) - Tuesday, March 28th from 15.00 to 16.00


Please come and chat with us about your research, your thoughts about chemistry, topics we should be blogging about, or anything else you’d like to discuss. In addition, we will be adding blog entries throughout the conference, so please check back frequently to see what we’re writing about… And please feel free to leave comments responding to this (and/or any other) entry – if you would like to contact us via email, please email us at thescepticalchymist at boston.nature.com

See you at the meeting!


Joshua Finkelstein (Associate Editor, Nature)
Terry Sheppard (Chief Editor, Nature Chemical Biology)
Stuart Cantrill (Associate Editor, Nature Nanotechnology)
Allison Doerr (Assistant Editor, Nature Methods)
Emma Marris (Washington Correspondent, Nature)
Jane Macmillan (Head of Marketing, Physical Sciences)
Jason Wilde (Publisher, Physical Sciences)

March 21, 2006

I want a new drug...


Nature Review Drug Discovery recently posted a "News and Analysis" article by Joanna Owens called "Funding for accelerating drug development initiative critical," which is about a new initiative launched by the United States Food and Drug Administration called "The Critical Path Initiative." According to the Critical Path website:

The Critical Path Initiative is FDA's effort to stimulate and facilitate a national effort to modernize the scientific process through which a potential human drug, biological product, or medical device is transformed from a discovery or "proof of concept" into a medical product.


To achieve this goal, Joanna says that

the FDA announced a list of 76 'opportunities', or projects, for developing new tools that could significantly improve the way that experimental drugs are tested. The opportunities cover six broad topic areas: development of biomarkers; clinical trial designs; bioinformatics; manufacturing; public health needs; and paediatrics.


So it looks like this initiative will complement the NIH Roadmap, which was launched several years ago to "identify major opportunities and gaps in biomedical research that no single institute at NIH could tackle alone."


I'm not sure if any of our readers are in the pharmaceutical industry, but I would be curious to hear what you think of these initiatives. Do you think that they'll have a positive impact on human health (i.e. will these initiatives actually accelerate drug discovery and development?) If you don't think that these initiatives will actually impact the number of new drugs coming to market, what do you think can (or should) be done? And if you are an academic scientist, what do you think about (another) governmental initiative that is focused on drug discovery and development, rather than pure scientific research?

Joshua


Joshua Finkelstein (Associate Editor, Nature)

March 20, 2006

One ring to rule them all...


The 2005 Nobel prize in chemistry went to Yves Chauvin, Robert Grubbs, and Richard Schrock "for the development of the metathesis method in organic synthesis." Olefin metathesis has been used to make a wide range of compounds, including natural products, polymers, and stabilized alpha helices that can inhibit the growth of human leukemia xenografts in vivo.

So it's not surprising that this field is still really "hot" - you can't open a chemistry journal without seeing at least one paper involving metathesis... In the March 22nd issue of the Journal of the American Chemical Society, Hong & Grubbs reported that a ruthenium catalyst that had a poly(ethylene glycol) conjugated saturated 1,3-dimesityl-4,5-dihydroimidazol-2-ylidene ligand was able to catalyze ring-opening metathesis polymerization, ring-closing metathesis, and cross-metathesis reactions in aqueous media (Highly Active Water-Soluble Olefin Metathesis Catalyst).

There's also a nice minireview by Donohoe et al. that just appeared on Angewandte Chemie International Edition's Early View - this minireview focused on papers in which ring-closing metathesis was used to synthesize aromatic compounds, including pyrroles, furans, and quinolines (Ring-Closing Metathesis as a Basis for the Construction of Aromatic Compounds).

Although Professor Donohoe won't be speaking at the upcoming American Chemical Society meeting in Atlanta, Professor Grubbs will give three talks: "Synthesis and applications of ROMP block polymers," "Olefin metathesis catalysts for the synthesis of large and small molecules," "Organic synthesis using the olefin metathesis reactions." Of course, he won't be the only scientist talking about metathesis at the meeting - there's a whole session devoted to metathesis on Sunday afternoon ("Recent Developments in Metathesis-Related Processes").

I'll be attending the upcoming ACS meeting and will be updating this blog regularly - so if you see any of these talks, please feel free to post a comment and let me know what you thought...

Joshua


Joshua Finkelstein (Associate Editor, Nature)

March 16, 2006

Chutes and ladderanes...


In 2002, Sinninghe Damste et al. showed that two anaerobic ammonium-oxidizing (anammox) bacteria contained a series of unusual lipids that had up to five linearly fused cyclobutane moieties with cis ring junctions (please also see the News & Views piece by Edward DeLong). These bacteria convert nitrite and ammonia into nitrogen gas in an organelle-like structure called the anammoxosome.

These unusual lipids had staircase-like structures, so the authors named these compounds "ladderanes." They proposed that the presence of these fatty acids turned the anammoxosome membrane into "a tight barrier against diffusion," which they postulated was necessary to "maintain concentration gradients during the exceptionally slow anammox metabolism and to protect the remainder of the cell from the toxic anammox intermediates" (for example, hydrazine and hydroxylamine).


The enantioselective synthesis of one of these unusual fatty acids - pentacycloanammoxic acid - was recently reported in the March 15th issue of the Journal of the American Chemical Society (Enantioselective Synthesis of Pentacycloanammoxic Acid by Mascitti & Corey). Several years ago, these same authors reported the racemic synthesis of this compound (Total Synthesis of (+/-)-Pentacycloanammoxic Acid), but this is the first enantioselective synthesis of this ladderane and it may be possible to use this enantiomerically pure compound to determine how these "ladderanes" are made in vivo. Mascitti & Corey discussed this briefly in the paper: "[i]f the biosynthesis were to occur by a cascade-type polycyclization, it would have to be novel in terms of the chemistry used because of the unfavorable energetics and the paucity of the known chemical reactions of this type." They also said "unraveling the biosynthetic mechanism ... [will be] as challenging as the chemical synthesis" - I don't know about you, but I can hardly wait to read the paper that explores the mechanism of ladderane synthase...

Joshua


Joshua Finkelstein (Associate Editor, Nature)

March 15, 2006

A special issue of Nature...


Hello again,

I just wanted to let you know that a special issue of Nature came out today, in which there were a number of exciting chemistry and biochemistry papers:

"Photocatalyst releasing hydrogen from water" by Maeda et al.
"Folding DNA to create nanoscale shapes and patterns" by Rothemund
"Stochastic protein expression in individual cells at the single molecule level" by Cai et al.
"The PerR transcription factor senses H2O2 by metal-catalysed histidine oxidation" by Lee & Helmann
"Crystal structure of the non-haem iron halogenase SyrB2 in syringomycin biosynthesis" by Blasiak et al.
"Structural basis for the spectral difference in luciferase bioluminescence" by Nakatsu et al.

Some of these papers are also featured on the 'Authors' page of this week's Nature, in our News & Views section (Rothemund and Nakatsu et al.), and on the March 16th edition of the Nature Podcast.


In addition, there's an interview with Nobel laureate Roald Hoffmann on his work with young scientists in the Middle East by Alison Abbott. As some of you may know, Professor Hoffmann shared the 1981 Nobel prize with Kenichi Fukui "for their theories, developed independently, concerning the course of chemical reactions." This isn't the first news piece we've published on Hoffman - Alison also wrote an interesting story on the controversy that surfaced in 2004 between Professor (and Nobel laureate) EJ Corey and Hoffmann.


There's also a 'Journal Club' entry by Professor David MacMillan, a NatureJobs article on green chemistry by Virginia Gewin, and an obituary for the natural-products chemist Pierre Potier. Potier was a natural-products chemist who (with several colleagues) found a way to produce large amounts of the anti-cancer compound paclitaxel (Taxol).


And our website now includes a ‘Web focus’ (a collection of recently published Nature papers) on metalloproteins. These proteins contain transition metals and are involved in a wide range of biologically-important processes, including natural product and cofactor biosynthesis, histone demethylation, and methane oxidation. For this reason, many chemists and biologists are determined to understand the mechanisms and the cellular roles of these remarkable enzymes. In addition, this knowledge can inspire bio-inorganic chemists to synthesize small-molecule catalysts based on the metal-containing active sites of these proteins. To highlight this exciting field, we have selected a panel of recently published Nature papers that explored the structures, mechanisms, and biological activities of several unusual metalloproteins. We hope you enjoy reading these papers as much as we did!


We'd love to hear what you think about this special issue - please feel free to leave us a comment or send us an email to let us know your thoughts...

Chat with you soon,

Joshua


Joshua Finkelstein (Associate Editor, Nature)

What's in a name?


Welcome to “The Sceptical Chymist,” a new blog from the editors of Nature and the Research journals.

We hope that you will help us fill this blog with stimulating discussions of all things chemical… This isn’t the first blog at Nature: there’s also the “Nature Newsblog,” “Free Association” (a blog from the editors of Nature Genetics), and “Action Potential” (a blog from the editors of Nature Neuroscience). But this is our first blog in the chemical sciences and we hope that you’ll help us make it a successful one!


So, what will you find in this blog? Here’s a (partial) list of what we plan on discussing:

- Meetings we’re attending, including the upcoming 2006 Spring meeting of the American Chemical Society

- Chemistry and biochemistry papers published in Nature journals and elsewhere

- Chemistry and chemists in the news, including scientific and popular press coverage, important policy developments, new initiatives in chemistry, etc.

- Upcoming conferences, newly published books about chemistry, and interesting websites we’ve found

- And anything else you’d like to talk about...


Now if you made it this far, you’re probably wondering why we named our blog “The Sceptical Chymist.” Well, it all has to do with a book written in 1661 by Robert Boyle, who is best known for Boyle’s law, and for co-founding the Royal Society on November 28th, 1660.

In 1661, Boyle published “The Sceptical Chymist,” in which he “argued against Aristotle's view of the four elements of earth, air, fire and water” and instead “argued that matter was composed of corpuscles which themselves were differently built up of different configurations of primary particles.”

Boyle criticized alchemists, calling them ”vulgar” and “inferior," and “appealed to chemists to experiment and … pleaded that chemistry cease being subservient to medicine or to alchemy, but rise to the status of a science.” Furthermore, he “advocated a rigorous approach to scientific experiment [and] believed all theories must be proved experimentally before being regarded as true.”

So it’s not surprising that Boyle has been called the “founder of modern chemistry” as well as the “father of chemistry.” We named this blog “The Sceptical Chymist” to pay homage to Boyle and the dramatic metamorphosis that took place after the publication of this book. By no means do we think that this blog will be a 21st century equivalent of this seminal text, but we hope that – like the original book – this blog will engage the chemical community, ask important questions, and make a positive impact on the field.


We will be adding entries regularly, so please check back frequently to see what we’re writing about… And please feel free to leave comments responding to this (and/or any other) entry – if you would like to contact us via email, please email us at thescepticalchymist at boston.nature.com

Chat with you soon!


Joshua Finkelstein (Associate Editor, Nature)
Terry Sheppard (Chief Editor, Nature Chemical Biology)
Stuart Cantrill (Associate Editor, Nature Nanotechnology)
Allison Doerr (Assistant Editor, Nature Methods)

Subscribe

Subscribe to this blog's feeds:

[What is this?]

Powered by
Movable Type 3.2