Main

August 20, 2007

ACS: Analyse this

I'm an organic chemist at heart, but for this meeting I've decided to explore beyond the wonders of total synthesis. So this morning, I attended one of the analytical chemistry sessions - and it was fascinating.

I opted for a session on metabolomics. For those of you who think this sounds like a rude word, let me tell you that it's the study of metabolites as markers for disease (or at least that's one application; it's impossible to do justice to the full range of possibilities in one blog entry).

The session began with a talk by Lily Tong, from Greg Stephanopoulous' lab. They were able to identify metabolites that are upregulated in patients that die of kidney failure. In this way, they were able to devise an accurate model to predict patients at most risk from the disease. Impressive stuff.

Rima Kaddurah-Daouk described a study of plasma taken from people with schizophrenia, and showed that each of three commonly-used antipsychotic drugs produces its own pattern of lipid-metabolite perturbation. This provides further evidence of the so-called 'lipid hypothesis' of schizophrenia, which suggests that the disease is not just caused by disturbances to neurotransmitters.

And finally, the award for gross presentation of the day goes to Andy Ewing, who is using fruitflies as models to study the effects of alcohol intoxication and dependence. This involves harvesting fruitflies' heads, and we were treated to some lovely pictures of his special fruitfly-head masher in action.

It's been a while since I looked at how metabolomics is progressing, and I was impressed at how far the field has come over the last few years. And now that I know fruitflies get drunk, I'll never look at them the same way again.

Andy


Andy Mitchinson (Associate Editor, Nature)

May 30, 2007

The weight


There's an interesting news piece over at news@nature.com that caught my eye - a team led by Helge Riemann at the Institute of Crystal Growth is trying to generate a 'pure' sample of crystalline silicon-28:

The new barbell-shaped crystal, which weighs 5 kilograms and was completed on 23 May by Riemann's team ... is nearly isotopically pure. It was made from Russian source material, whose silicon was 99.994% pure silicon-28.

A standard kilogram is currently calibrated using the "international prototype," which "was manufactured in the 1880s [from] an alloy of 90% platinum-10% iridium" and is housed in the Bureau International des Poids et Mesures in France. Over time, the loss and/or gain of atoms from the international prototype may have altered its weight - the news story suggests that it might be off by 0.1 milligrams/0.01% (but I couldn't find any additional information to verify that statement...)

Making this (two-million euro/2.7-million USD) piece of silicon was no easy task:

The researchers spent six months eliminating contaminating elements by repeatedly melting the silicon in an apparatus that does not touch the material. The resulting crystal is thought to contain one foreign atom to every 10 million atoms of silicon.

Talk about a pure sample...

Joshua


Joshua Finkelstein (Senior Editor, Nature)

February 02, 2007

Day TRP-per


Looking for something to read while you're waiting for the rotovap to free up or the PAGE gel to finish running? You might want to take a look at yesterday's issue of Nature, which has a number of chemistry/chemical papers. In addition to the paper by Serreli et al. that Katharine and Stuart mentioned, there's a News & Views piece from Steven Nolan on Craig Forsyth's recent ACIE paper and a paper from Stern et al. that describes miniature, ultra-sensitive sensors that can detect unlabeled antibodies at concentrations below 100 femtomolar (and can monitor the cellular immune response in 'real-time').

There's also a cool paper involving the TRPA1 channel - TRP channels respond to "temperature, touch, pain, osmolarity, pheromones, taste, and other stimuli," and the TRPA1 channel specifically responds to a range of structurally-diverse compounds, including mustard oil, acrolein, and icilin.

In Macpherson et al., the authors used 'click chemistry' to show that derivatives of mustard oil and cinnamaldehyde covalently bound to the TRPA1 channel. They used mass spectrometry to identify fourteen TRPA1 cysteine residues that reacted with iodoacetamide, three of which were required for normal channel function. From a chemical standpoint, this might not seem all that surprising, but this is apparently the first ion channel known to be activated by this mechanism, and I think it's interesting to see how "tuning TRPA1 to respond to covalent modification by reactive compounds ... [enables the nervous system to] directly assess the noxious environment of sensory neurons." For those of you teaching biological/bio-organic chemistry courses, this might make a good test question - it's a nice 'real world' example of how understanding basic organic chemistry can be used to explore how an enzyme works...

Joshua


Joshua Finkelstein (Senior Editor, Nature)

January 31, 2007

(Your love is like) bad medicine


I saw an amazing BBC documentary a few years ago called "Bad Medicine" - the documentary focused on Dora Akunyili, the Director General of Nigeria's National Agency for Food and Drug Administration and Control (NAFDAC), and her efforts to eradicate fake pharmaceuticals/counterfeit drugs in Nigeria.

Before Akunyili took over her post in 2001, a staggering 80% of the medications sold there were deficient in one way or another. Some contained less of the active ingredient than was specified on the label. Others were past their expiration date. Some were filled with inert lactose or powdered chalk.

The stories she told were astonishing: after cracking down on the counterfeiters, they "fought back ... [burning] down Nafdac's offices and threaten[ing] to kill her and her children"; "snipers opened fire on her car ... [and] a bullet pierced through [her] head scarf and grazed [her] scalp"; when the International Children's Heart Foundation visited Nigeria to perform heart surgery on children, four died because someone had replaced the adrenaline with water. It was a heart-wrenching documentary about how far some people will go to make money, and how hard it is to stop them: the World Health Organization "estimates up to 25% of medicines consumed in developing nations are counterfeit or substandard" and this problem isn't restricted to countries in the developing world.

So I was excited to read a recent news@nature.com story by Katharine Sanderson about a paper that just came out on Analytical Chemistry's ASAP. The authors used spatially offset Raman spectroscopy (SORS) to examine ibuprofen and paracetamol (acetaminophen), without removing them from their blister packs/bottles - the hope is that existing handheld Raman spectrometers could be turned into portable SORS detectors and that these devices could be used by people like Dora Akunyili to quickly determine whether or not a drug is counterfeit...

Joshua


Joshua Finkelstein (Senior Editor, Nature)

January 26, 2007

DIY Drug Discovery


Hi everyone - sorry it's been such a long time since I've posted. December and January are pretty crazy months around here... (There's usually a huge spike in submissions at the end of each year and it often takes a few weeks to work our way through the long backlog... Now that things have quieted down a bit, I hope to post more regularly...)

Anyways, a comment from yesterday's In the Pipeline caught my eye:

You never seem to discuss the current absymal [sic] state of employment for chemists. What reality are you living in? Maybe you should stick to the 'chemistry is fun talk'? You do your field a disservice by constantly ignoring reality.

Now I certainly don't want to trivialize how difficult it can be to find a job in the pharma/biotech sector, but those of you who aren't happy with your current position/are looking for another job might want to read this 'Careers and Recruitment' piece that was recently published in Nature Reviews Drug Discovery. The article focuses on two "biopharma company founders" - Alice Huxley (President and Chief Executive Officer, Speedel) and Dominic Behan (Chief Scientific Officer and Senior Vice President, Arena Pharmaceuticals) - who "discuss their experiences and highlight factors that have been important for success."

Huxley was a global project manager working on renin inhibitors, and after the merger of Sandoz and Ciba–Geigy (to create Novartis) it looked like that project was in jeopardy - Huxley "believed strongly in the potential" of the lead renin inhibitor in the program and was able to convince the management to "let me take on the project within Speedel and prove that it would work." The outcome? That compound - Aliskiren - is now in Phase III clinical trials. Behan founded Arena Pharmaceuticals with two colleagues in 1997 and has helped it grow to 300 employees. They now have a drug candidate - Lorcaserin - in Phase III trials for obesity and several other compounds in clinical and preclinical development.

So let's say you have a great idea and want to start your own company - what's the next step? How do you turn those late-night conversations at the pub with your coworkers into a real company? (And I don't mean a garden in your backyard that you call a 'massive pharmaceutical factory.') Though I know a few people who have started their own biotech companies (and though there's lots of information about venture capital companies on the web), I don't have any personal experience in this area... Maybe some of our readers have been through this process and know what to do next/who to approach with your ideas?

Joshua


Joshua Finkelstein (Senior Editor, Nature)

September 12, 2006

ACS: I love technology


David Schwartz gave a great talk this afternoon - he's the director of the National Institute of Environmental Health Sciences, which recently created the 'Genes and Environment Initiative,' a five-year research effort that hopes to identify the genetic and environmental causes of asthma, arthritis, and other common diseases.

The initiative has two components: the first involves "efficiently analyzing genetic variation in groups of patients with specific illnesses," and the second involves the development of new devices that can monitor "personal environmental exposures that interact with genetic variations and result in human diseases."

Why - you might ask - is the NIH spending approximately 192 million dollars on this new initiative? Well, we know that "[g]enetic and environmental factors, including diet and life-style, both contribute to cardiovascular disease, cancers, and other major causes of mortality," and there's a growing body of evidence that suggests that environmental factors are responsible for a large percentage of these diseases.

The NIEHS will use a portion of this money to fund grants that involve "innovative new technologies to measure environmental toxins, dietary intake and physical activity, and to determine an individual's biological response to those influences, using new tools of genomics, proteomics and metabolomics," so this looks like an excellent opportunity for chemists interested in complex diseases and human health.

For more information on the NIEHS 2006–2011 Strategic Plan, see "New Frontiers in Environmental Sciences and Human Health."

Joshua


Joshua Finkelstein (Associate Editor, Nature)

August 23, 2006

Come together


In the September issue of Nature Chemical Biology, John Silvius wrote about McGill University's interdepartmental graduate program in chemical biology, which was established in 2002 and now has "roughly 30 graduate students, 10 postdoctoral fellows and 30 faculty mentors."

The program involves scientists from the Department of Biochemistry, the Department of Chemistry, and the Department of Pharmacology and Therapeutics, and a "key objective of the program is to maximize opportunities for students with chemistry and life science backgrounds to share and appreciate their sometimes distinct perspectives on the field of chemical biology." Silvius wrote that this is accomplished via seminar discussion meetings, workshops, and an "annual research symposium at which students present their work to other students and faculty mentors."

There are other interdepartmental and multi-institutional graduate programs in chemical biology: for example, there is the Cornell/Rockefeller/Sloan-Kettering Tri-Institutional Training Program in Chemical Biology in New York City (which involves Cornell University, The Rockefeller University, Memorial Sloan-Kettering Cancer Center, and the Weill Medical College of Cornell). Graduate students in the Tri-Institutional Training Program can rotate in (and join) laboratories at any of the institutions and they do not have to teach classes, "enabling them to take an accelerated course schedule (four courses per semester during the first year)." (Although I understand that the program was designed so the students could take a large number of classes, I really enjoyed teaching during graduate school and think it's an important experience for all graduate students. But I'll save that topic for another blog post...)

There's obviously more than one way to train the next generation of chemical biologists, but Silvius believes that

An effective training program in chemical biology must produce graduates who have a distinct sense of intellectual identity yet can work effectively with researchers that are more conventionally trained either in chemistry or in the life sciences alone... Moreover, by promoting constant intermixing of individuals trained in the cultures of chemistry and biology, such a program allows students to be participants in the very type of stimulating, creative ferment that drives the field of chemical biology itself.

If you are a graduate student in (or a recent graduate of) an interdepartmental or multi-institutional graduate program in chemical biology, I'd be interested in hearing your thoughts about your program/your experiences. Why did you choose an interdepartmental or multi-institutional graduate program, instead of a Department of Chemistry & Chemical Biology? (And for those of you who did their graduate work in a Department of Chemistry & Chemical Biology, why didn't you choose an interdepartmental or multi-institutional graduate program?) For those of you working on the interface of other disciplines (for example, biophysics, chemical physics, bionanotechnology, etc.) did your graduate program meet your (scientific) needs/expectations? If not, what could they have done to make it easier for you to pursue interdisciplinary research?

Joshua


Joshua Finkelstein (Associate Editor, Nature)

July 28, 2006

The incredible shrinking lab


The collection, preparation, and analysis of chemical compounds using miniaturized devices are appealing for many reasons: the use of smaller reagent volumes can reduce the time needed to synthesize and analyze a product, the amount of chemical waste produced and the overall costs can be reduced by performing chemical reactions in these 'lab-on-a-chip' devices, and compact devices also allow samples to be analyzed at the point of need rather than at a centralized laboratory. For these reasons, chemists are now using these devices to create new molecules and materials, and biologists are employing these devices to study complex biological problems. Furthermore, labs on chips offer ‘point-of-care’ diagnostic abilities that could revolutionize medicine.

To highlight our interest in this exciting field, the July 27th issue of Nature contains an Insight (a collection of topical articles and reviews) which discuss the history, design, current applications, and the promising future of these 'lab-on-a-chip' devices:

The origins and the future of microfluidics (Whitesides)
Scaling and the design of miniaturized chemical-analysis systems (Janasek et al.)
Developing optofluidic technology through the fusion of microfluidics and optics (Psaltis et al.)
Future lab-on-a-chip technologies for interrogating individual molecules (Craighead)
Control and detection of chemical reactions in microfluidic systems (deMello)
Cells on chips (El-Ali et al.)
Microfluidic diagnostic technologies for global public health (Yager et al.)

There’s also a news story from Jenny Hogan on microreactors. (And you may want to check out 'Clicks and chips’ and Haswell’s recent News & Views article on Belder et al.)

For a complete list of Insights, click here - we hope you enjoy these reviews!

Joshua


Joshua Finkelstein (Associate Editor, Nature)

May 01, 2006

TCTTGTGAACCTACTATTTGTGCTCTTTGTCATTATATGATTTCTACT


It seems like every week there's some amazing new development involving 'lab on a chip' devices: in the May 9th issue of PNAS, Blazej et al. reported a nanoliter-scale microfabricated bioprocessor that was able to perform all three Sanger sequencing steps.

The device "incorporates a range of advanced lab-on-a-chip technologies, including miniaturized temperature sensing, nanoliter-scale Sanger extension reactions, microvalves/pumps, DNA affinity-capture, and high-performance CE." Like many other lab-on-a-chip devices, it's remarkably small (100 mm diameter) and the authors were able to sequence 556 continuous bases from 1 femtomole of a DNA template (with 99% accuracy).

Only 10e-15 moles of template? That's amazing! (And the raw sequencing data in Figure 4 looks fantastic...)

Since a "reaction containing 1 fmol of template generates [approximately] 26 times more product than is needed for detection,” the authors believe that they could run the reaction with only 100 attomoles of the DNA template. If this was done, “a sequencing reaction performed at standard concentrations in an easily fabricated 25-nl reactor [would represent] a 400-fold reduction in current sequencing reagent consumption.”

This is bound to make the NIH happy: "it still costs about $10 million to sequence 3 billion base pairs" and "NHGRI's near-term goal is to lower the cost of sequencing a mammalian-sized genome to $100,000, which would enable researchers to sequence the genomes of hundreds or even thousands of people as part of studies to identify genes that contribute to common, complex diseases." One of their long-term goals is to find a way to sequence a human-sized genome for $1,000 or less.

But the $1,000 genome would come with potential ethical concerns - I don't know about you, but I don't think I'd want my genome sequenced... I guess it would be good to know if I was genetically predisposed to get cancer or heart disease so I could take steps to prevent it, but part of me thinks that I'll enjoy life a bit more being blissfully ignorant... And what if the markers they discover are only right 90% of the time? Then I'd worry away my adulthood only to die of something else...

If you could get your genome sequenced during your next check-up, would you do it?

Joshua


Joshua Finkelstein (Associate Editor, Nature)

Subscribe

Subscribe to this blog's feeds:

[What is this?]

Powered by
Movable Type 3.2