Main

August 22, 2007

ACS: In my opinion, the drug is ready


Like Catherine, I'm a bit behind on scientific posts - so here's a quick recap of some of the talks I attended earlier in the week.

My Sunday morning started with an excellent session on malaria/anti-malarials - Solomon Nwaka from the World Health Organization's Special Programme for Research and Training in Tropical Diseases 'kicked off' the session with a broad overview that really drove home why malaria is (still) such an important disease: every 30 seconds a child dies from malaria, and the disease is responsible for more that one million deaths each year. Anti-malarial drug resistance is a huge problem (and there aren't that many new drug candidates in the pipeline), so the session focused on several academic scientists who are searching for new drug candidates. This is often done as a collaboration with Medicines for Malaria Venture, a non-profit organization created to “discover, develop and deliver new antimalarial drugs through public-private partnerships.” (For more information on public-private partnerships, click here and here).

I was only able to stay for the first half of the session, but I heard Jonathan Vennerstrom talk about synthetic peroxide anti-malarials (including this simplified analog of artemisinin) and Paul O'Neill talk about analogs of amodiaquine that were active against drug-resistant strains of malaria (click here for a recent review on 4-aminoquinoline anti-malarials).

The debate about whether or not academic scientists should try to get involved in drug discovery can get quite heated (see Derek Lowe's take on it here; you might also be interested in this NRDD 'Outlook'). Though I understand why some scientists think that academics should avoid this area of research, many pharmaceutical companies aren't willing (or able) to pursue a drug discovery program that focuses on malaria or other important, yet neglected, infectious diseases that disproportionately affect developing countries. (NITD and GSK are important exceptions to this general rule...)

So my question is if many pharmaceutical companies aren't willing/able to tackle these problems, why shouldn't academic groups give it a try?

Joshua


Joshua Finkelstein (Senior Editor, Nature)

April 24, 2007

Pour some sugar on me


In this week's issue of Nature, there's an Insight - a special collection of six or seven related review articles - on Glycochemistry & Glycobiology. In this particular Insight, there are seven review articles:

Chemical glycosylation in the synthesis of glycoconjugate antitumour vaccines from Galonic & Gin
Unusual sugar biosynthesis and natural product glycodiversification from Thibodeaux, Melancon, & Liu
Cycling of O-linked beta-N-acetylglucosamine on nucleocytoplasmic proteins from Hart, Housley, & Slawson
Glycan-based interactions involving vertebrate sialic-acid-recognizing proteins from Varki
Heparan sulphate proteoglycans fine-tune mammalian physiology from Bishop, Schuksz, & Esko
Exploiting the defensive sugars of HIV-1 for drug and vaccine design from Scanlan, Offer, Zitzmann, & Dwek
Synthesis and medical applications of oligosaccharides from Seeberger & Werz

There's also a paper from van Kasteren et al. (with a News & Views from Grotenbreg & Ploegh) describing a new chemical tagging approach that can be used to add multiple sugars to bare protein scaffolds (i.e., proteins that were over-expressed and purified from bacteria). (You may have also noticed Wang et al's paper in last week's Nature, so it looks like April may be the sweetest - and not the cruelest - month after all...)

As I wrote in the editorial that accompanies the Insight, scientists generally shy away from carbohydrates - I barely remember learning about them in my undergraduate years and spent little time thinking about them during graduate school. But now it seems like the field is exploding: everywhere you look there's an interesting paper about carbohydrate chemistry and biology.

So with that in mind, we've put together this collection of review articles to celebrate chemists and biologists working with carbohydrates... We hope you enjoy them!

Joshua


Joshua Finkelstein (Senior Editor, Nature)

March 25, 2007

ACS: My kind of town

I made it in to Chicago late last night (only two hours late, which for isn't that bad for O'Hare...) There must have been a few chemists on my flight, as I wasn't the only person who chuckled when they announced that our pilot's name was Dave Evans...

I got up early this morning to check email, plan my day at the conference, and make a few last minute adjustments to an iPod playlist (it's a 20-25 minute bus ride from my hotel to the convention center). When traveling for work, I usually create a playlist to 'match' the location of the conference: Radiohead works well if you're heading off to an RSC conference, but a meeting in Chicago really calls for some Robert Johnson and Muddy Waters... (This isn't always easy - I'm not sure what I'm going to do for the 2009 ACS meeting in Salt Lake City. Any suggestions?)


Anyways, this morning I saw a great talk from Dennis Dougherty - most of the talk focused on cation-pi interactions in ligand-gated ion channels (for example, the Cys-loop superfamily) and how his laboratory has used unnatural amino acid mutagenesis to dissect how nicotinic acetylcholine receptors work (click here for his Nature paper from 2005 - I think it's a great demonstration of how organic/physical organic chemistry can be used to reveal how a biological system works...)

After grabbing a quick (and remarkably expensive) bite to eat, I went to Linda Hsieh-Wilson's and Jotham Coe's talks, both of which were great. Coe talked about Varenicline/Chantix, which looks like it'll really be able to help people who want to quit smoking.


If you're blogging from the conference, please let us know/please feel free to mention it in the comments section - so far, I know that

Richard from Chemistry World
Egon from chem-bla-ics
Kyle from The Chem Blog

are here (I'm not sure if all of them are blogging, though...) As Katharine mentioned, her news@nature blog posts can be found here.

Joshua


Joshua Finkelstein (Senior Editor, Nature)

February 02, 2007

Day TRP-per


Looking for something to read while you're waiting for the rotovap to free up or the PAGE gel to finish running? You might want to take a look at yesterday's issue of Nature, which has a number of chemistry/chemical papers. In addition to the paper by Serreli et al. that Katharine and Stuart mentioned, there's a News & Views piece from Steven Nolan on Craig Forsyth's recent ACIE paper and a paper from Stern et al. that describes miniature, ultra-sensitive sensors that can detect unlabeled antibodies at concentrations below 100 femtomolar (and can monitor the cellular immune response in 'real-time').

There's also a cool paper involving the TRPA1 channel - TRP channels respond to "temperature, touch, pain, osmolarity, pheromones, taste, and other stimuli," and the TRPA1 channel specifically responds to a range of structurally-diverse compounds, including mustard oil, acrolein, and icilin.

In Macpherson et al., the authors used 'click chemistry' to show that derivatives of mustard oil and cinnamaldehyde covalently bound to the TRPA1 channel. They used mass spectrometry to identify fourteen TRPA1 cysteine residues that reacted with iodoacetamide, three of which were required for normal channel function. From a chemical standpoint, this might not seem all that surprising, but this is apparently the first ion channel known to be activated by this mechanism, and I think it's interesting to see how "tuning TRPA1 to respond to covalent modification by reactive compounds ... [enables the nervous system to] directly assess the noxious environment of sensory neurons." For those of you teaching biological/bio-organic chemistry courses, this might make a good test question - it's a nice 'real world' example of how understanding basic organic chemistry can be used to explore how an enzyme works...

Joshua


Joshua Finkelstein (Senior Editor, Nature)

January 31, 2007

(Your love is like) bad medicine


I saw an amazing BBC documentary a few years ago called "Bad Medicine" - the documentary focused on Dora Akunyili, the Director General of Nigeria's National Agency for Food and Drug Administration and Control (NAFDAC), and her efforts to eradicate fake pharmaceuticals/counterfeit drugs in Nigeria.

Before Akunyili took over her post in 2001, a staggering 80% of the medications sold there were deficient in one way or another. Some contained less of the active ingredient than was specified on the label. Others were past their expiration date. Some were filled with inert lactose or powdered chalk.

The stories she told were astonishing: after cracking down on the counterfeiters, they "fought back ... [burning] down Nafdac's offices and threaten[ing] to kill her and her children"; "snipers opened fire on her car ... [and] a bullet pierced through [her] head scarf and grazed [her] scalp"; when the International Children's Heart Foundation visited Nigeria to perform heart surgery on children, four died because someone had replaced the adrenaline with water. It was a heart-wrenching documentary about how far some people will go to make money, and how hard it is to stop them: the World Health Organization "estimates up to 25% of medicines consumed in developing nations are counterfeit or substandard" and this problem isn't restricted to countries in the developing world.

So I was excited to read a recent news@nature.com story by Katharine Sanderson about a paper that just came out on Analytical Chemistry's ASAP. The authors used spatially offset Raman spectroscopy (SORS) to examine ibuprofen and paracetamol (acetaminophen), without removing them from their blister packs/bottles - the hope is that existing handheld Raman spectrometers could be turned into portable SORS detectors and that these devices could be used by people like Dora Akunyili to quickly determine whether or not a drug is counterfeit...

Joshua


Joshua Finkelstein (Senior Editor, Nature)

January 26, 2007

DIY Drug Discovery


Hi everyone - sorry it's been such a long time since I've posted. December and January are pretty crazy months around here... (There's usually a huge spike in submissions at the end of each year and it often takes a few weeks to work our way through the long backlog... Now that things have quieted down a bit, I hope to post more regularly...)

Anyways, a comment from yesterday's In the Pipeline caught my eye:

You never seem to discuss the current absymal [sic] state of employment for chemists. What reality are you living in? Maybe you should stick to the 'chemistry is fun talk'? You do your field a disservice by constantly ignoring reality.

Now I certainly don't want to trivialize how difficult it can be to find a job in the pharma/biotech sector, but those of you who aren't happy with your current position/are looking for another job might want to read this 'Careers and Recruitment' piece that was recently published in Nature Reviews Drug Discovery. The article focuses on two "biopharma company founders" - Alice Huxley (President and Chief Executive Officer, Speedel) and Dominic Behan (Chief Scientific Officer and Senior Vice President, Arena Pharmaceuticals) - who "discuss their experiences and highlight factors that have been important for success."

Huxley was a global project manager working on renin inhibitors, and after the merger of Sandoz and Ciba–Geigy (to create Novartis) it looked like that project was in jeopardy - Huxley "believed strongly in the potential" of the lead renin inhibitor in the program and was able to convince the management to "let me take on the project within Speedel and prove that it would work." The outcome? That compound - Aliskiren - is now in Phase III clinical trials. Behan founded Arena Pharmaceuticals with two colleagues in 1997 and has helped it grow to 300 employees. They now have a drug candidate - Lorcaserin - in Phase III trials for obesity and several other compounds in clinical and preclinical development.

So let's say you have a great idea and want to start your own company - what's the next step? How do you turn those late-night conversations at the pub with your coworkers into a real company? (And I don't mean a garden in your backyard that you call a 'massive pharmaceutical factory.') Though I know a few people who have started their own biotech companies (and though there's lots of information about venture capital companies on the web), I don't have any personal experience in this area... Maybe some of our readers have been through this process and know what to do next/who to approach with your ideas?

Joshua


Joshua Finkelstein (Senior Editor, Nature)

September 14, 2006

ACS: Poly want an enzyme?

Polymers and biology, together in perfect harmony. This meeting has intrigued me with a number of sessions about bio-related polymers. Timothy Long's group had two: one about determining which physical properties of polymers make the best vectors for gene therapy, and one about using DNA base pairs to make a polymer with two sets of properties. Heat it to disassociate the base pairs, and you get a flowy substance, cool to clamp them together again, and you've got something strong enough to do something with. Plus, there's bio-inspired dental polymers from Temple University, enzymes in polymers for sensors from Hawaii Natural Energy Institute, and polymers derived from soybean oil, feathers, and rice. Finally, there was a presentation on making better cigarette filters from Salmon sperm, from the Ogata Research Laboratory, Ltd.

The general crush on bio-related polymers seems to stem from their ability to acquire reactive, "smart" properties from their biological components, as well as from the environmental advantages of making stuff from things that aren’t petroleum. Now, can they produce the self-drying jacket from Back to the Future II?

September 13, 2006

ACS: butternut squash soup

J.J. La Clair, the controversial chemist (for background, see http://www.nature.com/news/2006/060731/full/442492c.html) in the mutton chop sideburns, gave a talk today to a packed room. It was hot, stuffy, and young in there, as he talked us, mic-less, through what he called "an approach used in a number of labs that I've developed, optimized and made easier to use." As far as I could tell as a layman, the approach had to do with designing synthesis of natural products with florescent labeling and biological tests in mind. I'll leave an evaluation of the technical content to others more synthesis (or biology)-savvy than I. I'll just mention that his first slide talked about his Xenobe Research Institute (which is pronounced "zen-OH-bee"). His slide said that the company was working on 80 studies with academe, industry and government. He must be a pretty busy man.

He acknowledged the contretemps over his claimed synthesis of hexacyclinol—and even included on his acknowledgement page a shot of the T-shirt being sold which memorializes the controversy, saying that he salutes creativity in all forms. And yes, that was my headline on the shirt, but I didn't write it. Reporters very rarely write our own headlines—but we do get to write our own blog post titles. So I decree that the title of this post shall be: "butternut squash soup", since that is what I am eating right now.

ACS: Conference bon bons

-Our gung-ho enthusiasm for antidepressants mean that there is a certain amount of Prozac in the water these days. Freshwater mussels are less than pleased, though, since Prozac is making them release their larvae before they are viable. Freshwater mussels are sensitive creatures, and 70 percent of the species native to North America are extinct.

-In an irresistible item, a peculiar bird called the Black-Bone Silky Fowl has been found to be packed with carnosine, which has a rep for anti-aging and other positive health effects. The bird is a staple of Chinese medicine, and has soft white feathers over black flesh and bones.

-Check out the brand new Chemical Structure Lookup Service, hosted at NIH,. http://cactus.nci.nih.gov/cgi-bin/lookup/search

-Fucoxanthin, from brown seaweed, is taken up by the fat. It seems to both reduce adipose tissue and turn the fat a bright orange. Anti-obesity clinical trials are in the works.

-Adrienne Kozlowski, retired chemist, and her husband, have taken up hot air ballooning as a hobby. They say it is a perfect diversion for chemists, because manipulating the balloon is all a matter of mastering the laminar flow of the air.

-Peter Murray Rust, of Cambridge, on the future of Chemical information: "We are going to start mashing, and it is going to amaze the world."

September 12, 2006

ACS: Sweet surrender

I went to the carbohydrate-protein interactions and glycolipids session this morning (I'm at the ACS, in case you forgot). It was a great session! Even with the best efforts from the session chair, there were so many questions that we got way behind (which unfortunately meant that I missed George Wang's talk due to a previous engagement). One particularly interesting part of the morning was yet another tribute to Emil Fischer, who seems to have done more work in his life than occurs in a year at most universities. In this particular story, Jacqueline Gervay-Hague was discussing the troubles with substituting sugars at the alpha position, and had tried to use trimethylsilyl iodine in combination with an alcohol to activate the center and incorporate the alcohol as a substituent. To her amazement, her student didn't form the ester, but instead purified the iodated sugar. They looked back in the literature for any precedent of stable iodo-substituted sugars, and found that Fischer not only made them, but crystallized them back in 1910. The secret? The alpha-substituted sugar is stable, whereas the beta-functionalized position reacts right away. They have since used this insight to couple unprotected lipids to TMS-protected sugars; with the right purification conditions, they get the unprotected final product in one step.

Catherine Goodman (Assistant Editor, Nature Chemical Biology)

ACS: I love technology


David Schwartz gave a great talk this afternoon - he's the director of the National Institute of Environmental Health Sciences, which recently created the 'Genes and Environment Initiative,' a five-year research effort that hopes to identify the genetic and environmental causes of asthma, arthritis, and other common diseases.

The initiative has two components: the first involves "efficiently analyzing genetic variation in groups of patients with specific illnesses," and the second involves the development of new devices that can monitor "personal environmental exposures that interact with genetic variations and result in human diseases."

Why - you might ask - is the NIH spending approximately 192 million dollars on this new initiative? Well, we know that "[g]enetic and environmental factors, including diet and life-style, both contribute to cardiovascular disease, cancers, and other major causes of mortality," and there's a growing body of evidence that suggests that environmental factors are responsible for a large percentage of these diseases.

The NIEHS will use a portion of this money to fund grants that involve "innovative new technologies to measure environmental toxins, dietary intake and physical activity, and to determine an individual's biological response to those influences, using new tools of genomics, proteomics and metabolomics," so this looks like an excellent opportunity for chemists interested in complex diseases and human health.

For more information on the NIEHS 2006–2011 Strategic Plan, see "New Frontiers in Environmental Sciences and Human Health."

Joshua


Joshua Finkelstein (Associate Editor, Nature)

August 30, 2006

2 + 2 = 5


In the August 31st issue of Nature, there’s a short ‘picture story’ I wrote about a recent Cell paper from Lee et al. Those authors found that in Trypanosoma brucei (the parasite that causes African trypanosomiasis) the fatty acid myristate is not made by type I or type II fatty acid synthases, but is instead made by a series of enzymes called elongases. These enzymes extend the fatty acid chain, adding two carbon atoms at a time to a fatty acid that is attached to coenzyme A. Though more work is needed to explore how these enzymes function in vivo, the authors believe it may be possible to develop new anti-parasitic drugs that target these elongases.

According to the WHO/TDR, African trypanosomiasis (also known as 'sleeping sickness') affects 36 countries in sub-Saharan Africa and kills about 50,000 people each year. The TDR website says that "[t]reatment has always been difficult, especially when the disease has reached an advanced stage with central nervous system involvement, as few effective drugs are available." So hopefully small-molecule inhibitors of these enzymes could be used to reduce the morbidity and mortality associated with this disease.

If you're interested in reading more about their discovery, please go check out the picture story and the Cell paper.

Joshua


Joshua Finkelstein (Associate Editor, Nature)

August 29, 2006

Turn on, tune in, kill cells


If you read ScientificAmerican.com or the BBC News website this week, you may have heard about Putt et al., which was recently published in Nature Chemical Biology.

Procaspase-3 is an inactive form of caspase-3 (a cysteine protease involved in apoptosis) and the "conversion of procaspase-3 to caspase-3 results in the generation of the active 'executioner' caspase that subsequently catalyzes the hydrolysis of many protein substrates." Putt et al. screened a library of 20,500 compounds and identified a small-molecule - named PAC-1 - that activated procaspase-3 in vitro. They then showed that the small-molecule could induce apoptosis in a variety of cancer cell lines. Since PAC-1 was orally active in live mice and was able to retard tumor growth in three cancer models, the authors believe that this molecule (or its derivatives) could be used to treat cancer in humans one day.

If you want to learn more about the work and you’re attending the fall ACS meeting, Karson Putt will be talking about the work on Tuesday, September 12th in the Medicinal Chemistry Award Symposium. Paul Hergenrother will also be talking in that session (and receiving the award), though he will focus on new small-molecules that might be able to combat Parkinson's Disease.

Joshua


Joshua Finkelstein (Associate Editor, Nature)

August 23, 2006

Come together


In the September issue of Nature Chemical Biology, John Silvius wrote about McGill University's interdepartmental graduate program in chemical biology, which was established in 2002 and now has "roughly 30 graduate students, 10 postdoctoral fellows and 30 faculty mentors."

The program involves scientists from the Department of Biochemistry, the Department of Chemistry, and the Department of Pharmacology and Therapeutics, and a "key objective of the program is to maximize opportunities for students with chemistry and life science backgrounds to share and appreciate their sometimes distinct perspectives on the field of chemical biology." Silvius wrote that this is accomplished via seminar discussion meetings, workshops, and an "annual research symposium at which students present their work to other students and faculty mentors."

There are other interdepartmental and multi-institutional graduate programs in chemical biology: for example, there is the Cornell/Rockefeller/Sloan-Kettering Tri-Institutional Training Program in Chemical Biology in New York City (which involves Cornell University, The Rockefeller University, Memorial Sloan-Kettering Cancer Center, and the Weill Medical College of Cornell). Graduate students in the Tri-Institutional Training Program can rotate in (and join) laboratories at any of the institutions and they do not have to teach classes, "enabling them to take an accelerated course schedule (four courses per semester during the first year)." (Although I understand that the program was designed so the students could take a large number of classes, I really enjoyed teaching during graduate school and think it's an important experience for all graduate students. But I'll save that topic for another blog post...)

There's obviously more than one way to train the next generation of chemical biologists, but Silvius believes that

An effective training program in chemical biology must produce graduates who have a distinct sense of intellectual identity yet can work effectively with researchers that are more conventionally trained either in chemistry or in the life sciences alone... Moreover, by promoting constant intermixing of individuals trained in the cultures of chemistry and biology, such a program allows students to be participants in the very type of stimulating, creative ferment that drives the field of chemical biology itself.

If you are a graduate student in (or a recent graduate of) an interdepartmental or multi-institutional graduate program in chemical biology, I'd be interested in hearing your thoughts about your program/your experiences. Why did you choose an interdepartmental or multi-institutional graduate program, instead of a Department of Chemistry & Chemical Biology? (And for those of you who did their graduate work in a Department of Chemistry & Chemical Biology, why didn't you choose an interdepartmental or multi-institutional graduate program?) For those of you working on the interface of other disciplines (for example, biophysics, chemical physics, bionanotechnology, etc.) did your graduate program meet your (scientific) needs/expectations? If not, what could they have done to make it easier for you to pursue interdisciplinary research?

Joshua


Joshua Finkelstein (Associate Editor, Nature)

August 17, 2006

Endosymbiotic by nature


You might remember endosymbiotic theory from your high school or college biology classes: it's the idea that some organelles (for example, mitochondria and chloroplasts) were originally separate prokaryotic organisms that were engulfed by eukaryotic cells. Although it's not clear how or why this occurred, this became a mutually beneficial relationship for both cells (i.e., a symbiotic relationship), resulting in the organelle-containing cells that appear in biology textbooks (and in our bodies...)

But why - you might ask - would a chemist care about endosymbionts (organisms that live inside other organisms)? Well I think they're interesting because "[b]acterial symbionts have long been suspected to be the true producers of many drug candidates" isolated from natural sources. For example, there is some evidence that the antitumor polyketides of the pederin family are produced by an uncultured bacterial symbiont of Paederus beetles, which can cause dermatitis.

Late last year, Partida-Martinez & Hertweck discovered that another natural product (rhizoxin) is not biosynthesized by the fungus Rhizopus microsporus itself, but by a bacteria that lives inside the fungus. In a follow-up paper in JACS, these authors were able to isolate a rhizoxin-producing bacterial strain from the fungus ("Burkholderia rhizoxina") and could grow it in liquid culture. They lysed the cells, and found (quite surprisingly) that "about 40% of the crude extract is composed of rhizoxin derivatives" - in addition to rhizoxin, Burkholderia rhizoxina produces a number of related structures.

The authors determined that some of these natural products were 1,000 to 10,000 times more active than rhizoxin in cell-based assays (the assay was looking at antiproliferative activity). Rhizoxin went through extensive clinical trials in the 1990s and showed some promise as an anti-cancer drug, though it was not taken into Phase III clinical trials because it was not active enough in vivo. These authors hope that, since the derivatives they isolated are more active in vitro, they might more successful in the clinic. And since the natural products can be harvested from bacterial cultures, it may be possible to rapidly produce a large amount of these complex natural products without having to resort to chemical synthesis.

Joshua


Joshua Finkelstein (Associate Editor, Nature)

July 28, 2006

The incredible shrinking lab


The collection, preparation, and analysis of chemical compounds using miniaturized devices are appealing for many reasons: the use of smaller reagent volumes can reduce the time needed to synthesize and analyze a product, the amount of chemical waste produced and the overall costs can be reduced by performing chemical reactions in these 'lab-on-a-chip' devices, and compact devices also allow samples to be analyzed at the point of need rather than at a centralized laboratory. For these reasons, chemists are now using these devices to create new molecules and materials, and biologists are employing these devices to study complex biological problems. Furthermore, labs on chips offer ‘point-of-care’ diagnostic abilities that could revolutionize medicine.

To highlight our interest in this exciting field, the July 27th issue of Nature contains an Insight (a collection of topical articles and reviews) which discuss the history, design, current applications, and the promising future of these 'lab-on-a-chip' devices:

The origins and the future of microfluidics (Whitesides)
Scaling and the design of miniaturized chemical-analysis systems (Janasek et al.)
Developing optofluidic technology through the fusion of microfluidics and optics (Psaltis et al.)
Future lab-on-a-chip technologies for interrogating individual molecules (Craighead)
Control and detection of chemical reactions in microfluidic systems (deMello)
Cells on chips (El-Ali et al.)
Microfluidic diagnostic technologies for global public health (Yager et al.)

There’s also a news story from Jenny Hogan on microreactors. (And you may want to check out 'Clicks and chips’ and Haswell’s recent News & Views article on Belder et al.)

For a complete list of Insights, click here - we hope you enjoy these reviews!

Joshua


Joshua Finkelstein (Associate Editor, Nature)

July 10, 2006

Growing pains in chemical biology

Each month, Nature Chemical Biology includes an editorial; these typically center around an issue of general importance to chemical biologists and seek to raise questions that will be significant in the further development of the field. In the July issue, we talk about how universities and departments may support the development of chemical biologists . As science has expanded from the strict disciplines of chemistry, biology, and physics, certain challenges of redefining scientific borders and academic structure have been met. Yet the experience of researchers working in chemical biology suggests that they face a uniquely difficult task in finding a home for themselves and their work. Everyone involved would benefit from brainstorming on how the integration of chemical biology can be improved or made easier. As such, we would like to initiate conversation among our readers as well as those who have gone through similar fundamental shifts in scientific organization.

Some of the thoughts on our mind:

What is your experience in starting a lab/changing fields/getting funding for chemical biology research?

Are there specific changes that your university has made or could make to support you?

Do you think chemical biologists can continue to work within the confines of diverse (other) disciplines, or do you support the move toward chemical biology departments?

How can we find common ground when self-identified chemical biologists work on extremely disparate topics or use widely varying techniques?

It is our hope that, by sharing ideas and concerns, we can improve the overall understanding of and support for our growing community.

July 07, 2006

Bring on the beer


You probably know someone with Celiac disease, as it affects approximately one out of every 250 people, who "cannot tolerate a protein called gluten, found in wheat, rye, and barley." (Others estimate that the prevalence of this disease is even higher, as it may be underdiagnosed in some populations.)

There's no cure for this disease, so people with Celiac disease must change their diet and avoid gluten for the rest of their life. This can be challenging (unless gluten-free labels appear on the food), because in addition to the obvious places, "gluten is also 'hidden' in many processed foods such as frozen French fried potatoes, soy sauce and rice cereal. Even many non-food items like cosmetics, and household cleansers contain gluten." The risk of cross-contamination from other foods can present problems when eating in restaurants or traveling, and beer lovers will need to switch to gluten-free beer...

In the June 26th issue of Chemistry & Biology, Siegel et al. determined that two enzymes (a glutamine-specific cysteine protease from barley and a prolyl endopeptidase) could be used to degrade gluten in an acidic environment - neither enzyme worked very well on its own, but the combination was able to detoxify "grocery store gluten ... within 10 min of simulated duodenal conditions."

The hope is that these enzymes could be taken orally by someone with Celiac disease before eating (like Lactaid for lactose-intolerant people), helping them "cope with the 'hidden' gluten in everyday life ... [and enabling them to] resume a more normal diet."

Joshua


Joshua Finkelstein (Associate Editor, Nature)

Save the date


If you're free in early November, you might want to attend the 2006 Nature Chemical Biology Symposium, which will be on November 10th & 11th at the Museum of Science in Boston.

The meeting's focus is the "frontier of in vivo chemical biology" and there are five sessions:

The nucleus and cell division
Metal ions and metabolites
Cytoplasmic processes
Membranes
Cell and chemical biology moving forward

Carolyn Bertozzi and James Rothman are the Keynote Speakers, and the rest of the program really looks fantastic...

Hope to see you there...

Joshua


Joshua Finkelstein (Associate Editor, Nature)

June 15, 2006

Bruce Merrifield


I'm sure many of you know that Bruce Merrifield passed away a few weeks ago. In today's issue of Nature, Stephen Kent wrote an obituary describing Merrifield and his accomplishments.

If your institution subscribes to the ACS archives, you can download "Solid Phase Peptide Synthesis. I. The Synthesis of a Tetrapeptide" (you should be able to download the first page for free). According to C&EN, this was the "fifth most cited paper in the journal’s 125-year history."

You may also want to take a look at Gutte's & Merrifield's classic 1971 JACS paper, in which they reported the synthesis of ribonuclease A (124 amino acids long: this "required 369 chemical reactions and 11,931 steps of the automated peptide synthesis machine without any intermediate isolation steps.")

Merrifield also wrote two reviews in Science (in 1965 and 1986) - they're both pretty interesting reviews (and it's amazing to see how much changed in those 21 years...)

Joshua


Joshua Finkelstein (Associate Editor, Nature)

June 05, 2006

OK Computer


Chemical & Engineering News published a brief news story today on Ashworth et al., which appeared in the June 1st issue of Nature. In that paper, the authors showed that computational protein design could be used to alter the specificity of the homing endonuclease I-MsoI. The redesigned enzyme was highly active and it cleaved the new recognition sequence about 10,000 times more effectively (in vitro) than the wild-type enzyme.

Earlier this year, David Liu's laboratory demonstrated that it was possible to use directed evolution to modify the specificity of another homing endonuclease (I-SceI), but Ashworth et al. is the first paper in which computational protein design was successfully used to modify the specificity of a homing endonuclease.

The authors say that "the method should be generalizable to any protein–DNA interface redesign problem: for example, the reprogramming of transcription factor binding specificity" and they believe that "[t]he use and refinement of the computational modelling and design strategies described here should ... [enable them to design] novel proteins [that are] able to recognize and cleave any desired DNA site with high specificity for targeted genomics applications."

Joshua


Joshua Finkelstein (Associate Editor, Nature)

May 30, 2006

Everything bad is good again


One of my favorite scenes in Woody Allen's 1973 film Sleeper involves two doctors (for those of you who haven't seen this film, most of the movie takes place in the year 2173):

Dr. Melik: [puzzling over list of items sold at Miles' old health-food store] ... wheat germ, organic honey and ... tiger's milk.
Dr. Aragon: Oh, yes. Those are the charmed substances that some years ago were thought to contain life-preserving properties.
Dr. Melik: You mean there was no deep fat? No steak or cream pies or ... hot fudge?
Dr. Aragon: [chuckling] Those were thought to be unhealthy ... precisely the opposite of what we now know to be true.
Dr. Melik: Incredible!

I thought of this scene when I first heard about the possible beneficial properties of red wine (back in 1992, when Siemann & Creasy proposed that resveratrol might be responsible for the cardioprotective effects of red wine). Although I drink quite a bit of red wine, I hadn't really thought much about resveratrol until I read a new review article by Baur & Sinclair that's on the Nature Reviews Drug Discovery Advance Online Publication page.

Since that original report back in 1992, the number of papers exploring resveratrol's biological activity has skyrocketed: according to Baur & Sinclair resveratrol has been shown to "prevent or slow the progression of a wide variety of illnesses, including cancer, cardiovascular disease and ischaemic injuries, as well as enhance stress resistance and extend the lifespans of various organisms from yeast to vertebrates."

Not a big fan of red wine? No problem - there are many other natural sources of resveratrol, including grape juice, blueberries, and pistachios (although the concentration of resveratrol is much higher in red wine...)

We still need to learn more about the physiologically-relevant mechanism(s) of action, and the authors suggest that "blocking the metabolism of resveratrol, developing analogues with improved bioavailability, or finding new, more potent compounds that mimic its effects" will be important, as resveratrol is not cheap: "administering a daily dose to a human weighing 75 kg with 100 mg per kg (body weight) of resveratrol would require 2.7 kg of resveratrol a year, at a current cost of about US$6,800."

This blog entry has made me thirsty for some wine tonight - I think I'll stop off at the wine store on the way home and pick up a nice Syrah or maybe a bottle of French wine - anything red is fine, as long as it's not a Merlot...

Joshua


Joshua Finkelstein (Associate Editor, Nature)

May 24, 2006

Happy birthday, Nature Chemical Biology!


Nature Chemical Biology is now one year old, and the editors have put together a special anniversary issue to celebrate: in addition to the usual selection of exciting primary research, this issue has a meeting report by Jennifer Kohler on the recent American Society for Biochemistry and Molecular Biology meeting (which had a great series of talks in the "Chemical Genetics and Drug Discovery" section) and a review article by Jason Chin on synthetic biology. (If you're interested in synthetic biology, you might want to check out the Nature Newsblog for Oliver Morton's thoughts on the Second International Conference on Synthetic Biology.)

This special issue has a new section called "Elements," which "will feature interviews with key people in the chemical biology community and offer insights into places or events that are of general interest to chemists and biologists." In this issue, Joanne Kotz talks with Harvard Professor Jeremy Knowles.

Lastly, the editorial team at Nature Chemical Biology has put together a selection of papers from their first 12 issues, all of which are free for the month of June.

Joshua


Joshua Finkelstein (Associate Editor, Nature).

May 12, 2006

I am the Lorax. I speak for the trees...


While flipping through yesterday's issue of Nature, I came across the special report on toxicology/toxicologists in the Naturejobs section... After struggling to get that infernal Britney Spears song out of my head, I read through the article, which really made toxicology sound like an interesting career...

Ricki Lewis wrote that a "career in toxicology might take a scientist to a contaminated well, a crime scene, a courtroom, an analytical chemistry lab or a political hearing" and "it isn't uncommon for a seasoned scientist to have spent time in academia, industry and government, and finish with private consulting." Considering how successful shows like CSI and Numb3rs are, I'm a bit surprised that no one's produced a prime-time TV drama starring toxicologists (I can see it now - EPA: Risk Assessment Unit...)


There's also a nice News & Views article by Robert Crabtree on a recent Science paper from the Goldman and Brookhart laboratories - in the presence of an iridium catalyst and a Schrock metathesis catalyst, the authors reported that a tandem alkane dehydrogenation/olefin metathesis reaction could be used to elongate inert hydrocarbon chains (technically, it's a tandem alkane dehydrogenation/olefin metathesis/alkane hydrogenation reaction, but that's a bit of a mouthful...)

The authors hope that this system could be used "turn coal, leftover oil refinery products or even plants into diesel fuel and other functional hydrocarbons." But Professor Brookhart acknowledged that "considerable improvements in the catalyst systems are required before they become practical."

Joshua


Joshua Finkelstein (Associate Editor, Nature)

May 08, 2006

Doing the worm...


Despite its small size (about one millimeter long), the nematode Caenorhabditis elegans has been used to study a wide range of "biological processes including apoptosis, cell signalling, cell cycle, cell polarity, gene regulation, metabolism, ageing and sex determination." Which is pretty amazing, as it truly is a simple organism: the adult hermaphrodite has 959 somatic cells!

In the May issue of Nature Reviews Drug Discovery, Kaletta & Hengartner wrote:

The cellular complexity and the conservation of disease pathways between C. elegans and higher organisms, together with the simplicity and cost-effectiveness of cultivation, make for an effective in vivo model that is amenable to whole-organism high-throughput compound screens and large-scale target validation.

I was surprised to learn that complex diseases can be investigated using this worm - scientists are even using it to "identify additional mode of actions of fluoxetine [an antidepressant] and to further elucidate the molecular mechanism of depression."

C. elegans is getting a lot of attention at NPG this week: in the May 4th issue of Nature, Kwok et al. screened 14,100 small-molecules in living worms and identified 308 compounds that induced a range of phenotypes, including slow growth, lethality, uncoordinated movement and morphological defects. One of these small-molecules (a 1,4-dihydropyridine that they named nemadipine-A) induced an Egl phenotype (egg-laying defects).

The authors then screened 180,000 "randomly mutated wild-type genomes" to look for dominant genetic suppressors of the nemadipine-A-induced phenotype, and they performed a number of follow-up experiments that indicated that the protein Egl-19 (the only L-type calcium channel alpha1-subunit in C. elegans) is a target of nemadipine-A.

This isn’t completely unsurprising, as other 1,4-dihydropyridines are known to "antagonize the alpha1-subunit of L-type calcium channels"), but it's an important demonstration that C. elegans can be used to quickly identify the targets of biologically active small-molecules - to quote Professor Randall Peterson, "[t]arget identification has been one of the thorniest problems in small-molecule screening, so this is a welcome and encouraging advance." And it's so simple, Professor Peter Roy (the lead author of the study) said "I could teach a first-year undergrad to do it"...

Joshua


Joshua Finkelstein (Associate Editor, Nature)

May 01, 2006

TCTTGTGAACCTACTATTTGTGCTCTTTGTCATTATATGATTTCTACT


It seems like every week there's some amazing new development involving 'lab on a chip' devices: in the May 9th issue of PNAS, Blazej et al. reported a nanoliter-scale microfabricated bioprocessor that was able to perform all three Sanger sequencing steps.

The device "incorporates a range of advanced lab-on-a-chip technologies, including miniaturized temperature sensing, nanoliter-scale Sanger extension reactions, microvalves/pumps, DNA affinity-capture, and high-performance CE." Like many other lab-on-a-chip devices, it's remarkably small (100 mm diameter) and the authors were able to sequence 556 continuous bases from 1 femtomole of a DNA template (with 99% accuracy).

Only 10e-15 moles of template? That's amazing! (And the raw sequencing data in Figure 4 looks fantastic...)

Since a "reaction containing 1 fmol of template generates [approximately] 26 times more product than is needed for detection,” the authors believe that they could run the reaction with only 100 attomoles of the DNA template. If this was done, “a sequencing reaction performed at standard concentrations in an easily fabricated 25-nl reactor [would represent] a 400-fold reduction in current sequencing reagent consumption.”

This is bound to make the NIH happy: "it still costs about $10 million to sequence 3 billion base pairs" and "NHGRI's near-term goal is to lower the cost of sequencing a mammalian-sized genome to $100,000, which would enable researchers to sequence the genomes of hundreds or even thousands of people as part of studies to identify genes that contribute to common, complex diseases." One of their long-term goals is to find a way to sequence a human-sized genome for $1,000 or less.

But the $1,000 genome would come with potential ethical concerns - I don't know about you, but I don't think I'd want my genome sequenced... I guess it would be good to know if I was genetically predisposed to get cancer or heart disease so I could take steps to prevent it, but part of me thinks that I'll enjoy life a bit more being blissfully ignorant... And what if the markers they discover are only right 90% of the time? Then I'd worry away my adulthood only to die of something else...

If you could get your genome sequenced during your next check-up, would you do it?

Joshua


Joshua Finkelstein (Associate Editor, Nature)

April 28, 2006

Why did the chicken cross the road?


With H5N1 avian influenza gradually making its way across the world, a lot of people are preparing for the worst. It's still not clear if this strain of the flu will 'evolve the ability to spread between people,' but if this happens, we're in for some serious problems:

Supplies of vaccines and antiviral drugs – the two most important medical interventions for reducing illness and deaths during a pandemic – will be inadequate in all countries at the start of a pandemic and for many months thereafter ... WHO has used a relatively conservative estimate – from 2 million to 7.4 million deaths – because it provides a useful and plausible planning target. This estimate is based on the comparatively mild 1957 pandemic. Estimates based on a more virulent virus, closer to the one seen in 1918, have been made and are much higher.

The current syntheses of oseltamivir (a.k.a. Tamiflu) fall 'short of the ideal for several reasons: (1) the starting point in the synthesis is either (-)-shikimic or (-)-quinic acid, which are complex relatively expensive and of limited availability, and (2) two steps involve potentially hazardous and explosive azide-containing intermediates.'

But two new syntheses of oseltamivir/Tamiflu were reported in JACS earlier this week: one is by Yeung et al. and the other is by Fukuta et al.

Although the synthesis from Corey's group is much shorter, both syntheses avoid using either (-)-shikimic or (-)-quinic acid as starting materials: Corey's synthesis starts with 1,3-butadiene and trifluoroethyl acrylate and Shibasaki's synthesis starts with the asymmetric ring-opening reaction of a meso-aziridine with TMSN3. If these syntheses could be scaled up and optimized further, it might be possible to reduce the cost of oseltamivir/Tamiflu and pharmaceutical companies (or paranoid graduate students) could make plenty of the compound, which could be stockpiled and used if a human pandemic occurs.

The only catch: oseltamivir-resistant virus has already been reported in Vietnam...

Joshua


Joshua Finkelstein (Associate Editor, Nature)