Main

October 10, 2007

Eyes on the prize

Well, I guess you’ve all heard the news by now that Gerhard Ertl has won the Nobel Prize in chemistry this year. This is, in my opinion, a thoroughly deserved award, which recognizes Ertl’s achievements in surface chemistry. He is one of the fathers of the area, famous for his seminal work on hydrogen adsorption to metal surfaces, the mechanism of the Haber-Bosch process and the oxidation of carbon monoxide on platinum. The Nobel Prize website has an excellent summary of his work here.

So did any of you predict the result? Top marks must surely go to Paul at ChemBark, who did indeed include Ertl on his shortlist of possible winners. I imagine all eyes will be on ChemBark next year for more top tips.

Of course, no Nobel prize can go by without some controversy, and some people are questioning why Gabor Somorjai (who was jointly awarded the Wolf Prize for chemistry with Ertl in 1998) wasn’t also honoured. But then again, the Nobel judges always seem to come in for criticism – I remember in previous years they were knocked for including too many winners…

I’ll be curious to see how much coverage the chemistry prize gets in the national press. The prize for medicine certainly attracted a lot of attention in the UK (but of course, one of the prizewinners was a Brit). The physics prize seems to have had less coverage, despite being branded as “The Physics of the iPod”. This year’s chemistry prize has perhaps the most obvious real-world relevance of recent Nobel awards for the subject - but will that be enough to inspire the press?

Andy


Andrew Mitchinson (Associate Editor, Nature)

March 25, 2007

ACS: My kind of town

I made it in to Chicago late last night (only two hours late, which for isn't that bad for O'Hare...) There must have been a few chemists on my flight, as I wasn't the only person who chuckled when they announced that our pilot's name was Dave Evans...

I got up early this morning to check email, plan my day at the conference, and make a few last minute adjustments to an iPod playlist (it's a 20-25 minute bus ride from my hotel to the convention center). When traveling for work, I usually create a playlist to 'match' the location of the conference: Radiohead works well if you're heading off to an RSC conference, but a meeting in Chicago really calls for some Robert Johnson and Muddy Waters... (This isn't always easy - I'm not sure what I'm going to do for the 2009 ACS meeting in Salt Lake City. Any suggestions?)


Anyways, this morning I saw a great talk from Dennis Dougherty - most of the talk focused on cation-pi interactions in ligand-gated ion channels (for example, the Cys-loop superfamily) and how his laboratory has used unnatural amino acid mutagenesis to dissect how nicotinic acetylcholine receptors work (click here for his Nature paper from 2005 - I think it's a great demonstration of how organic/physical organic chemistry can be used to reveal how a biological system works...)

After grabbing a quick (and remarkably expensive) bite to eat, I went to Linda Hsieh-Wilson's and Jotham Coe's talks, both of which were great. Coe talked about Varenicline/Chantix, which looks like it'll really be able to help people who want to quit smoking.


If you're blogging from the conference, please let us know/please feel free to mention it in the comments section - so far, I know that

Richard from Chemistry World
Egon from chem-bla-ics
Kyle from The Chem Blog

are here (I'm not sure if all of them are blogging, though...) As Katharine mentioned, her news@nature blog posts can be found here.

Joshua


Joshua Finkelstein (Senior Editor, Nature)

September 14, 2006

ACS: Poly want an enzyme?

Polymers and biology, together in perfect harmony. This meeting has intrigued me with a number of sessions about bio-related polymers. Timothy Long's group had two: one about determining which physical properties of polymers make the best vectors for gene therapy, and one about using DNA base pairs to make a polymer with two sets of properties. Heat it to disassociate the base pairs, and you get a flowy substance, cool to clamp them together again, and you've got something strong enough to do something with. Plus, there's bio-inspired dental polymers from Temple University, enzymes in polymers for sensors from Hawaii Natural Energy Institute, and polymers derived from soybean oil, feathers, and rice. Finally, there was a presentation on making better cigarette filters from Salmon sperm, from the Ogata Research Laboratory, Ltd.

The general crush on bio-related polymers seems to stem from their ability to acquire reactive, "smart" properties from their biological components, as well as from the environmental advantages of making stuff from things that aren’t petroleum. Now, can they produce the self-drying jacket from Back to the Future II?

September 13, 2006

ACS: Clicking and beeping

I went to a talk on by UCSB's Robert Vestberg, on "Synthesis of hydrogels with well defined network structure using Click chemistry", because I have been hearing this buzzword floating around – "click chemistry"—and I wanted to figure out what it was.

But first, hydrogels. Hydrogels are polymers all cross-linked together and stuffed with water. They can be useful in medicine, for example, as soft contact lenses. They are biocompatible, key molecules can diffuse through them, and they are tough. Often the crosslinks are induced by a blast of radiation—like UV light, for example.

Vestberg and his colleagues are using "click chemistry" to do their linking. The click concept was described quickly as a reaction catalyzed by copper (I) that seems to be a one-size-fits-all room temp process that organizes your molecules into a regular structure. Functional groups can be knitted right in.

At least that was the impression I got. The meeting room in the Marriot was next to some sort of noisy kitchen or workroom, and it was hard to concentrate. It sounded like they were banging the lumps out of large cookie sheets on the other side of the wall. The "backing up" beep of some kind of vehicle was also intermittently heard.

Anyway, the hydrogels are made in little Teflon molds. You can make them with other fluids besides water, too. "We've done it in crappy Australian wine that I got from my boss," says Vestberg, who is pleased with his gels, which can be stretched to 1500% their original length before they break, much more than UV crosslinked hydrogels.

After the talk, I did some reading on click chemistry, which was invented by Barry Sharpless. It seems like a kind of Lego chemistry to me. You may be interested to know that searching the program of abstracts for this meeting with the term "click" yields 42 hits.

September 12, 2006

ACS: I love technology


David Schwartz gave a great talk this afternoon - he's the director of the National Institute of Environmental Health Sciences, which recently created the 'Genes and Environment Initiative,' a five-year research effort that hopes to identify the genetic and environmental causes of asthma, arthritis, and other common diseases.

The initiative has two components: the first involves "efficiently analyzing genetic variation in groups of patients with specific illnesses," and the second involves the development of new devices that can monitor "personal environmental exposures that interact with genetic variations and result in human diseases."

Why - you might ask - is the NIH spending approximately 192 million dollars on this new initiative? Well, we know that "[g]enetic and environmental factors, including diet and life-style, both contribute to cardiovascular disease, cancers, and other major causes of mortality," and there's a growing body of evidence that suggests that environmental factors are responsible for a large percentage of these diseases.

The NIEHS will use a portion of this money to fund grants that involve "innovative new technologies to measure environmental toxins, dietary intake and physical activity, and to determine an individual's biological response to those influences, using new tools of genomics, proteomics and metabolomics," so this looks like an excellent opportunity for chemists interested in complex diseases and human health.

For more information on the NIEHS 2006–2011 Strategic Plan, see "New Frontiers in Environmental Sciences and Human Health."

Joshua


Joshua Finkelstein (Associate Editor, Nature)

August 23, 2006

Come together


In the September issue of Nature Chemical Biology, John Silvius wrote about McGill University's interdepartmental graduate program in chemical biology, which was established in 2002 and now has "roughly 30 graduate students, 10 postdoctoral fellows and 30 faculty mentors."

The program involves scientists from the Department of Biochemistry, the Department of Chemistry, and the Department of Pharmacology and Therapeutics, and a "key objective of the program is to maximize opportunities for students with chemistry and life science backgrounds to share and appreciate their sometimes distinct perspectives on the field of chemical biology." Silvius wrote that this is accomplished via seminar discussion meetings, workshops, and an "annual research symposium at which students present their work to other students and faculty mentors."

There are other interdepartmental and multi-institutional graduate programs in chemical biology: for example, there is the Cornell/Rockefeller/Sloan-Kettering Tri-Institutional Training Program in Chemical Biology in New York City (which involves Cornell University, The Rockefeller University, Memorial Sloan-Kettering Cancer Center, and the Weill Medical College of Cornell). Graduate students in the Tri-Institutional Training Program can rotate in (and join) laboratories at any of the institutions and they do not have to teach classes, "enabling them to take an accelerated course schedule (four courses per semester during the first year)." (Although I understand that the program was designed so the students could take a large number of classes, I really enjoyed teaching during graduate school and think it's an important experience for all graduate students. But I'll save that topic for another blog post...)

There's obviously more than one way to train the next generation of chemical biologists, but Silvius believes that

An effective training program in chemical biology must produce graduates who have a distinct sense of intellectual identity yet can work effectively with researchers that are more conventionally trained either in chemistry or in the life sciences alone... Moreover, by promoting constant intermixing of individuals trained in the cultures of chemistry and biology, such a program allows students to be participants in the very type of stimulating, creative ferment that drives the field of chemical biology itself.

If you are a graduate student in (or a recent graduate of) an interdepartmental or multi-institutional graduate program in chemical biology, I'd be interested in hearing your thoughts about your program/your experiences. Why did you choose an interdepartmental or multi-institutional graduate program, instead of a Department of Chemistry & Chemical Biology? (And for those of you who did their graduate work in a Department of Chemistry & Chemical Biology, why didn't you choose an interdepartmental or multi-institutional graduate program?) For those of you working on the interface of other disciplines (for example, biophysics, chemical physics, bionanotechnology, etc.) did your graduate program meet your (scientific) needs/expectations? If not, what could they have done to make it easier for you to pursue interdisciplinary research?

Joshua


Joshua Finkelstein (Associate Editor, Nature)

July 28, 2006

The incredible shrinking lab


The collection, preparation, and analysis of chemical compounds using miniaturized devices are appealing for many reasons: the use of smaller reagent volumes can reduce the time needed to synthesize and analyze a product, the amount of chemical waste produced and the overall costs can be reduced by performing chemical reactions in these 'lab-on-a-chip' devices, and compact devices also allow samples to be analyzed at the point of need rather than at a centralized laboratory. For these reasons, chemists are now using these devices to create new molecules and materials, and biologists are employing these devices to study complex biological problems. Furthermore, labs on chips offer ‘point-of-care’ diagnostic abilities that could revolutionize medicine.

To highlight our interest in this exciting field, the July 27th issue of Nature contains an Insight (a collection of topical articles and reviews) which discuss the history, design, current applications, and the promising future of these 'lab-on-a-chip' devices:

The origins and the future of microfluidics (Whitesides)
Scaling and the design of miniaturized chemical-analysis systems (Janasek et al.)
Developing optofluidic technology through the fusion of microfluidics and optics (Psaltis et al.)
Future lab-on-a-chip technologies for interrogating individual molecules (Craighead)
Control and detection of chemical reactions in microfluidic systems (deMello)
Cells on chips (El-Ali et al.)
Microfluidic diagnostic technologies for global public health (Yager et al.)

There’s also a news story from Jenny Hogan on microreactors. (And you may want to check out 'Clicks and chips’ and Haswell’s recent News & Views article on Belder et al.)

For a complete list of Insights, click here - we hope you enjoy these reviews!

Joshua


Joshua Finkelstein (Associate Editor, Nature)

May 01, 2006

TCTTGTGAACCTACTATTTGTGCTCTTTGTCATTATATGATTTCTACT


It seems like every week there's some amazing new development involving 'lab on a chip' devices: in the May 9th issue of PNAS, Blazej et al. reported a nanoliter-scale microfabricated bioprocessor that was able to perform all three Sanger sequencing steps.

The device "incorporates a range of advanced lab-on-a-chip technologies, including miniaturized temperature sensing, nanoliter-scale Sanger extension reactions, microvalves/pumps, DNA affinity-capture, and high-performance CE." Like many other lab-on-a-chip devices, it's remarkably small (100 mm diameter) and the authors were able to sequence 556 continuous bases from 1 femtomole of a DNA template (with 99% accuracy).

Only 10e-15 moles of template? That's amazing! (And the raw sequencing data in Figure 4 looks fantastic...)

Since a "reaction containing 1 fmol of template generates [approximately] 26 times more product than is needed for detection,” the authors believe that they could run the reaction with only 100 attomoles of the DNA template. If this was done, “a sequencing reaction performed at standard concentrations in an easily fabricated 25-nl reactor [would represent] a 400-fold reduction in current sequencing reagent consumption.”

This is bound to make the NIH happy: "it still costs about $10 million to sequence 3 billion base pairs" and "NHGRI's near-term goal is to lower the cost of sequencing a mammalian-sized genome to $100,000, which would enable researchers to sequence the genomes of hundreds or even thousands of people as part of studies to identify genes that contribute to common, complex diseases." One of their long-term goals is to find a way to sequence a human-sized genome for $1,000 or less.

But the $1,000 genome would come with potential ethical concerns - I don't know about you, but I don't think I'd want my genome sequenced... I guess it would be good to know if I was genetically predisposed to get cancer or heart disease so I could take steps to prevent it, but part of me thinks that I'll enjoy life a bit more being blissfully ignorant... And what if the markers they discover are only right 90% of the time? Then I'd worry away my adulthood only to die of something else...

If you could get your genome sequenced during your next check-up, would you do it?

Joshua


Joshua Finkelstein (Associate Editor, Nature)

April 14, 2006

I like to move it, move it...


In today's issue of Science, there's a nice review on protein dynamics by Mittermaier & Kay and a paper on the dynamics and function of a peptidyl carrier protein domain of tyrocidine A synthetase. In their review, Mittermaier & Kay wrote:

Recent methodological advancements in NMR have extended our ability to characterize protein dynamics and promise to shed new light on the mechanisms by which these molecules function ... NMR spectroscopy is uniquely suited to study many of these dynamic processes, because site-specific information can be obtained for motions that span many time scales, from rapid bond librations (picoseconds) to events that take seconds.

Although I'm sure X-ray crystallography will still be widely used to determine the three dimensional structures of proteins in the future, I think we'll start to hear more about the utility of NMR spectroscopy, especially since there are a number of NIH-funded structural genomics centers that are using NMR spectroscopy to solve protein structures, there are new labeling methods that may make it possible to use NMR to solve the structures of larger proteins, and there are exciting demonstrations of how solid-state NMR can be used to probe the structure and function of membrane proteins.

NMR can also be used to find important biologically active small-molecules/potential drugs - for example, Oltersdorf et al. used NMR to find and optimize a new anti-cancer compound and Forino et al. used a "fragment-based approach" to find a new inhibitor of the lethal factor metalloproteinase from Bacillus anthracis.

Of course, many of these experiments can't be done on an aging NMR spectrometer. In a recent Nature paper, Dorothee Kern's group used a Varian 800-MHz spectrometer to examine the dynamics of the prolyl cis-trans isomerase cyclophilin A. 800-MHz spectrometers will need to get a lot cheaper before many laboratories can afford to use them routinely...

Joshua


Joshua Finkelstein (Associate Editor, Nature)

Subscribe

Subscribe to this blog's feeds:

[What is this?]

Powered by
Movable Type 3.2