Doing the worm…

Despite its small size (about one millimeter long), the nematode Caenorhabditis elegans has been used to study a wide range of “”https://www.nature.com/nrd/journal/v5/n5/full/nrd2031.html">biological processes including apoptosis, cell signalling, cell cycle, cell polarity, gene regulation, metabolism, ageing and sex determination." Which is pretty amazing, as it truly is a simple organism: the adult hermaphrodite has 959 somatic cells!

In the May issue of Nature Reviews Drug Discovery, Kaletta & Hengartner wrote:

The cellular complexity and the conservation of disease pathways between C. elegans and higher organisms, together with the simplicity and cost-effectiveness of cultivation, make for an effective in vivo model that is amenable to whole-organism high-throughput compound screens and large-scale target validation.

I was surprised to learn that complex diseases can be investigated using this worm – scientists are even using it to “”https://www.nature.com/nrd/journal/v5/n5/full/nrd2031.html">identify additional mode of actions of fluoxetine [an antidepressant] and to further elucidate the molecular mechanism of depression."

C. elegans is getting a lot of attention at NPG this week: in the May 4th issue of Nature, Kwok et al. screened 14,100 small-molecules in living worms and identified 308 compounds that induced a range of phenotypes, including slow growth, lethality, uncoordinated movement and morphological defects. One of these small-molecules (a 1,4-dihydropyridine that they named nemadipine-A) induced an Egl phenotype (egg-laying defects).

The authors then screened 180,000 “”https://www.nature.com/nature/journal/v441/n7089/full/nature04657.html">randomly mutated wild-type genomes" to look for dominant genetic suppressors of the nemadipine-A-induced phenotype, and they performed a number of follow-up experiments that indicated that the protein Egl-19 (the only L-type calcium channel alpha1-subunit in C. elegans) is a target of nemadipine-A.

This isn’t completely unsurprising, as other 1,4-dihydropyridines are known to “”https://www.nature.com/nature/journal/v441/n7089/full/nature04657.html">antagonize the alpha1-subunit of L-type calcium channels“), but it’s an important demonstration that C. elegans can be used to quickly identify the targets of biologically active small-molecules – to quote Professor ”https://www.mgh.harvard.edu/cvrc/crvc/peterson/index.html">Randall Peterson, “”https://pubs.acs.org/cen/news/84/i19/8419notw8.html">[t]arget identification has been one of the thorniest problems in small-molecule screening, so this is a welcome and encouraging advance." And it’s so simple, Professor Peter Roy (the lead author of the study) said “”https://pubs.acs.org/cen/news/84/i19/8419notw8.html">I could teach a first-year undergrad to do it"…

Joshua

Joshua Finkelstein (Associate Editor, Nature)

TCTTGTGAACCTACTATTTGTGCTCTTTGTCATTATATGATTTCTACT

It seems like every week there’s some amazing new development involving ‘lab on a chip’ devices: in the May 9th issue of PNAS, Blazej et al. reported a nanoliter-scale microfabricated bioprocessor that was able to perform all three Sanger sequencing steps.

The device “”https://www.pnas.org/cgi/reprint/0602476103v1">incorporates a range of advanced lab-on-a-chip technologies, including miniaturized temperature sensing, nanoliter-scale Sanger extension reactions, microvalves/pumps, DNA affinity-capture, and high-performance CE." Like many other lab-on-a-chip devices, it’s remarkably small (100 mm diameter) and the authors were able to sequence 556 continuous bases from 1 femtomole of a DNA template (with 99% accuracy).

Only 10e-15 moles of template? That’s amazing! (And the raw sequencing data in Figure 4 looks fantastic…)

Since a “”https://www.pnas.org/cgi/reprint/0602476103v1">reaction containing 1 fmol of template generates [approximately] 26 times more product than is needed for detection,” the authors believe that they could run the reaction with only 100 attomoles of the DNA template. If this was done, “a sequencing reaction performed at standard concentrations in an easily fabricated 25-nl reactor [would represent] a 400-fold reduction in current sequencing reagent consumption.”

This is bound to make the NIH happy: “”https://www.genome.gov/15015208">it still costs about $10 million to sequence 3 billion base pairs" and “”https://www.genome.gov/15015208">NHGRI’s near-term goal is to lower the cost of sequencing a mammalian-sized genome to $100,000, which would enable researchers to sequence the genomes of hundreds or even thousands of people as part of studies to identify genes that contribute to common, complex diseases." One of their long-term goals is to find a way to sequence a human-sized genome for $1,000 or less.

But the $1,000 genome would come with potential ethical concerns – I don’t know about you, but I don’t think I’d want my genome sequenced… I guess it would be good to know if I was genetically predisposed to get cancer or heart disease so I could take steps to prevent it, but part of me thinks that I’ll enjoy life a bit more being blissfully ignorant… And what if the markers they discover are only right 90% of the time? Then I’d worry away my adulthood only to die of something else…

If you could get your genome sequenced during your next check-up, would you do it?

Joshua

Joshua Finkelstein (Associate Editor, Nature)